Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element

Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensu DNA sequence element (ATCGAAAGATAGGAAAGAAGCAAT). The results imply that the 20 bp consensus DNA sequence element is importnat for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated.Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element.