Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such a...
Gespeichert in:
Veröffentlicht in: | Analytical biochemistry 2011-08, Vol.415 (2), p.175-181 |
---|---|
Hauptverfasser: | , , , , , , , , |
Format: | Artikel |
Sprache: | eng |
Schlagworte: | |
Online-Zugang: | Volltext |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (
K
d [kanamycin]
=
78.8
nM,
K
d [kanamycin B]
=
84.5
nM, and
K
d [tobramycin]
=
103
nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25
nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products. |
---|---|
ISSN: | 0003-2697 1096-0309 |
DOI: | 10.1016/j.ab.2011.04.007 |