Identification of the DNA Sequences Controlling the Expression of the MATα Locus of Yeast

We have excised a 28-base-pair DNA fragment from the MATα intergenic region and tested its ability to direct diploid-specific transcriptional repression. This fragment (1643-1671, 5′- GCTTCCCAATGTAGAAAAGTACATCATA -3′) lies within a region required for the normal diploid-specific repression of the MATα transcripts. First, the fragment was inserted into a 53-base-pair MATα deletion that expresses α 1 and α 2 constitutively. Insertion of the fragment restores proper diploid regulation to the MATα transcripts: α 1 mRNA is strongly repressed and α 2 mRNA is reduced by a factor of ≈ 10 from its haploid level. The fragment works equally well in either orientation, and two copies of the fragment do not lead to stronger repression than a single copy. We also inserted the fragment at three sites upstream of the CYC1-lacZ fusion gene. Insertions placing the regulatory fragment between the CYC1 upstream activator sequence (UAS) and the coding region make β -galactosidase efficiently in α haploids but produce 1/40th the enzyme in a/α diploids. This diploid-specific repression requires functional MATa-1 gene product. Insertion of the MAT fragment on the opposite side of the UAS (37 base pairs upstream of the UAS) also caused diploid repression of the fusion gene, but only by a factor of 7. When the regulatory fragment is inserted at a large distance on the far side of the UAS (375 base pairs), it has little if any effect on β -galactosidase expression. We postulate that this sequence is the operator recognized by the diploid-specific repressor.