Probing Hydrogen Bonding in a DNA Triple Helix Using Protium−Deuterium Fractionation Factors

In this communication we report protium−deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5‘-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3‘. The fractionation factors of individual Watson−Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson−Crick hydrogen bonds. Deviations from the average are observed for the 5‘-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.