Occurrence of the Reniform Nematode Rotylenchulus reniformis on Sponge Gourd ( Luffa cylindrica ) in Yunnan Province, China

Sponge gourd ( ) is an important annual climbing herbaceous crop used as edible vegetable, industrial material and medicine crop. It is widely cultivated in China. In October 2019, six root and rhizosphere soil samples were collected from a field growing sponge gourd (cv. Zaoxiu 6) in Caoba Town, Mengzi City, Yunnan Province, China. Sponge gourd roots exhibited distinct brown lesions, while above-ground symptoms of plants were not observed in this field at sampling. Nematodes were extracted from soil using the modified tray method, and nematodes in root tissues were observed using the acid fuchsin method (Whitehead and Hemming 1965; Bybd et al. 1983). Reniform nematodes ( ) were found in all samples with population densities of 447 ± 120 nematodes/100 g of soil and 52 ± 21 nematodes/1.0 g of root. The immature females were vermiform and ventrally curved to spiral-shaped upon fixation, with a conoid and continuous lip region, slender and well-developed stylet with rounded basal knobs and oesophageal glands overlapping the intestine laterally and mostly ventrally. The tails was slightly tapering to a rounded tip with distinct hyaline tail terminus. Morphological measurements of immature females (n = 20) included body length (L) = 392.3 ± 20.4 μm (352.8 to 436.7 μm), stylet = 18.6 ± 0.5 μm (17.6 to 19.4 μm), tail length= 25.9 ± 2.2 μm (20.1 to 29.9 μm), a = 25.2 ± 1.1 (23.5 to 27.3), b = 3.2 ± 0.4 (2.6 to 4.0), c = 15.2 ± 1.2 (13.6 to 18.6), c' = 2.9 ± 0.3 (2.2 to 3.3), V = 70.3 ± 1.0 (68.5 to 72.6). The males were vermiform with poorly developed stylet and esophageal median bulb, ventrally arcuate spicule, and indistinct bursa. Measurements of males (n = 20) were L = 426.7 ± 31.0 μm (368.1 to 463.9 μm), stylet = 12.8 ± 0.8 μm (11.2 to 14.1 μm), tail length= 26.3 ± 1.8 μm (24.3 to 29.4 μm), spicule = 20.6 ± 0.9 μm (19.6 to 22.7 μm), a = 27.7 ± 2.2 (25.2 to 30.7), b = 4.5 ± 0.4 (3.9 to 4.8), c = 15.5 ±0.9 (14.7 to 16.8), c' = 2.8 ± 0.3 (2.5 to 3.2). These morphological characters were similar to those described for (Palomares-Rius et al. 2018). Genomic DNA was extracted from single immature females as described by Song et al. (2021). The rDNA-ITS region and D2-D3 region of the 28S rRNA gene were amplified using primers 18s/26s (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) and D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA), respectively (Vrain et al. 1992; Subbotin et al. 2006). The obtained rDNA-ITS sequence (1003 bp, GenBank accession No. MT332839) an