First report of rhizome rot of banana caused by Klebsiella variicola in India
Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in co...
Gespeichert in:
Veröffentlicht in: | Plant disease 2021-07, Vol.105 (7), p.2011 |
---|---|
Hauptverfasser: | , , , , , , |
Format: | Artikel |
Sprache: | eng |
Online-Zugang: | Volltext |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5' - AGAGTTTGATCCTGGCTCAG - 3'; 1492 R 5' - GGTTACCTTGTTACGACTT - 3') and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in |
---|---|
ISSN: | 0191-2917 1943-7692 |
DOI: | 10.1094/PDIS-10-20-2316-PDN |