Nonframeshifting indel variations in polyalanine repeat of HOXD13 gene underlies hereditary limb malformation for two Chinese families

Background Polydactyly and syndactyly are the most common hereditary limb malformations. Molecular genetic testing is of great significance for hereditary limb malformations, which can establish prognosis and recurrence risk of surgical intervention. Methods The present study aimed to identify the genetic etiologies of a three‐generation family with postaxial polydactyly and a four‐generation family with postaxial syndactyly. Whole exome sequencing was used, followed by standard mutation screening procedure, Sanger sequencing and bioinformatics analysis. Results Two nonframeshifting insertion/deletion (indel) mutations in HOXD13 (c.206_207ins AGCGGCGGCTGCGGCGGCGGCGGC:p.A68insAAAAAAAA or c.171_182delGGCGGCGGCGGC: p.56_60delAAAA) were successfully identified as the pathogenic mutation. The two nonframeshifting indel mutations led to truncation or expansion of homopolymeric alanine (Poly‐Ala) repeats of HOXD13 proteins. Sequence alignment of HOXD13 protein among many different species for Poly‐Ala position is highly conserved. Hypothetical three‐dimensional (3‐D) structural analysis further showed mutant HOXD13 proteins (p.A68insAAAAAAAA and p.56_60delAAAA) converted the disordered fragment into a short β‐strand (residues 63‐68 or residues 64‐68), thereby forming a conformational change. Conclusions The present study identified two nonframeshifting mutations of HOXD13 polyalanine repeat location in two Chinese families with postaxial polydactyly or postaxial syndactyly. Our results also provide new insights into genetic counseling and clinical management. Key Findings Hereditary limb malformation, whole‐exome sequencing, HOXD13 gene, nonframeshifting indel