Sequence variability within the ORF AC1 of begomovirus isolates infecting sweetpotato in Kenya

Begomovirus isolates, similar to Sweet potato leaf curl virus (SPLCV), have recently been reported infecting sweetpotato in East Africa. Sequence variability of six isolates from Kenya was studied using partial sequence of the ORF AC1, a region that has been used in previous studies with different SPLCV isolates. Variability was studied by cloning and sequencing a 512-bp fragment from ORF AC1 that had been amplified by PCR using primers PW285-1 (TAATTCGAACTGCAGTTCCGTATTTCAGTT) and PW285-2 (GCTAGAGGAGGCCTGCAGACTGCTAACGACG). Sequence comparisons of the six isolates resulted in 93-100% nucleotide sequence identity and 96-100% amino acid sequence similarity. Phylogenetic analyses of the Kenyan begomovirus isolates with other characterized sweetpotato begomo-viruses resulted in the Kenyan isolates clustering together and were closely related to SPLCV-US.