First Report of Strawberry polerovirus 1 in Argentina

Strawberry (Fragaria x ananassa Duch.) can be infected with multiple viruses in single or mixed infections producing severe symptoms and significant yield reduction. Among aphid-borne viruses, Strawberry mild yellow edge virus(SMYEV), Strawberry crinkle virus(SCV), and Strawberry mottle virus(SMoV) have been detected in Argentina. Strawberry plants with dwarfism, general weakness, distorted leaves, occasional chlorosis, few flowers, and poor fruit quality are observed often in Argentina. The productivity of these affected plants is greatly reduced. Symptomatic plants from Tucuman, Argentina (26[degrees]55'22" S; 65[degrees]20'15" W), were collected from the field and maintained in a greenhouse. Total RNA was extracted from leaves using an RNeasy Plant Mini Kit (QIAGEN, Valencia, CA, USA) according to manufacturer's instructions, and subjected to next-generation sequencing (NGS) at the Genomics and Bioinformatics Platform, INDEAR Inc., Rosario, Argentina, using Roche 454 Genome Sequencer FLX+. The sequence reads were quality filtered and assembled into contigs using the Newbler Assembly v2.5.3 software (Roche). Contigs were analyzed using NCBI's Open Reading Frame (ORF) Finder and BLAST. Two contigs showed high identity with Polerovirus genera. The first 624-nt contig (GenBank Accession No. KR094960) containing an ORF showed 99% identity with coat protein gene, and the second 847-nt contig 98% identity with the RNA-dependent RNA polymerase of Strawberry polerovirus 1 (KM233706.1 and KM233705.1) (Xiang et al. 2015). Based on the partial RNA-dependent RNA polymerase sequence obtained and Strawberry polerovirus 1 sequence at GenBank, four specific primers were designed: Polero47Fw (GAGTGTCACCACCCCTCACTAC) / Polero2Rv (AGGCCTACACCAGCATCTAACTCA) that amplify a fragment of 897 nt, and Polero2Fw (CCAACTAGCCAAGATCCCATCTGAAG) / Polero40Rv (CGAGACCTCGACTTTGAAACCCA) that amplify a fragment of 1030 nt, both from the polymerase cistron of the virus. Since there are no commercial antisera available for Strawberry polerovirus 1, virus testing by reverse transcription polymerase chain reaction (RT-PCR) with the primers listed above was carried out. Fresh leaf tissue samples were collected individually from 44 symptomatic strawberry plants and tested using RT-PCR. PCR fragments of the expected size were amplified from 10 plants confirming the polerovirus presence. Two polerovirus positive strawberry plants, analyzed by RT-PCR using the primers designed, were used for petiol