First Report of Cucumber mosaic virus (CMV) and CARNA-5 in Carnation in Mexico

In 2008, during a survey conducted in commercial greenhouses in Coatepec Harinas County in the State of Mexico, several viral symptoms, such as leaf mottle and severe plant deformation, were observed in many young carnation (Dianthus caryophyllus) plants. Carnation mottle virus(CarMV) and Carnation etched ring virus(CERV) were detected in single and mixed infections by DAS-ELISA, electrophoretic dsRNA assay, and dot-blot analysis using digoxigenin labeled riboprobes. The identity of both viruses was confirmed by sequencing the coat protein gene (CP) amplicons obtained by RT-PCR (De La Torre-Almaraz et al. 2015). The dsRNA electrophoretic analysis of carnation plants with severe leaf deformation showed, in addition of the expected viral CarMV bands, the presence of other dsRNA fragments compatible with the expected pattern of Cucumber mosaic virus(CMV) genome and its CARNA-5 satellite. Dot-blot analysis using the dsRNA extracts and a digoxigenin-labeled CMV riboprobe complementary to the CP gene (Sanchez-Navarro et al. 1999) rendered positive hybridization signals for the 33.3% of the analyzed samples (8 out 24). The enriched dsRNA extracts were additionally tested by one-step RT-PCR using primer pairs to amplify the CMV CP gene (2426sCMVRNA3-1130: CTTTTTCATGGATGCTTCTCC and 2427AsCMVRNA3-1994: AGCTGGATGGACAACCCGTTC). In the case of the CARNA-5 satellite, the samples were first subjected to RACE analysis to determinate the 5' and 3' termini sequences using specific primers targeting conserved internal regions (2371sCARNA5-154: TTTGAGCCCCCGCTCAGTTTGC and 2372AsCARNA5-186: GCAAACTGAGCGGGGGCTCAAA). In a second step, we designed specific primers corresponding to the 5' (2404sCARNA5: GTTTTGTTTGATGGAGAATTGCG) and 3' (2405AsCARNA5: GGGTCCTGTAGAGGAATGTATAG) termini. The RT-PCR fragments obtained from both the CMV CP gene and the full length CARNA-5 were purified from agarose gels and cloned in the pTZ57R vector (InsT/Aclone PCR, Fermentas). The nucleotide sequences of the CMV (GenBank Accession No. KU144674) and CARNA-5 (KU144672 and KU144673) amplified fragments were determined using several clones. BLAST analysis of the CMV sequences showed nucleotide and amino acid identity values of 98 to 89% and 98 to 77%, respectively, with the corresponding CMV sequences of the database (AJ585518 and GU906293; AGN56102 and AAA19319); meanwhile, CARNA-5 sequences showed nucleotide identity values of 93 to 83% with CARNA-5 sequences available in the database (U43889 and X86423)