First Report of Zucchini yellow mosaic virus and Squash mosaic virus Infecting Cucurbits in Trinidad

Cucurbits are major food crops of the Caribbean region and cultivated in 27% of fields in Trinidad with an average production of 2,750 tons (pumpkin, squash, and gourds) per year (http://faostat3.fao.org/browse/Q/QC/E). For the past two years, we have noticed plants showing disease symptoms including severe mosaic and yellowing of leaves and severe fruit deformation and color cracking in pumpkin and squash in all the cultivars grown in Trinidad. The infection was suspected to be caused by Zucchini yellow mosaic virus(ZYMV) (Hasiow-Jaroszewska et al. 2013; Desbiez and Lecoq 1997). Detailed surveys to record the severity of disease were conducted during dry and rainy seasons for a two-year period in farmers' fields in six different locations (Barrackpore, Macoya, Las Lomas, Moruga, Waterloo, and Orange Groove) representing all the major cropping zones of the country. Virus infection was noticed at all growth stages of the crop and a maximum disease incidence of 74% was recorded in the dry season during 2014 and 2015. The leaf samples from 60 suspected pumpkin plants (10 per location) were collected from the fields, and total RNAs were isolated. RNA (1 [mu]g) was used for cDNA synthesis and PCR was performed with ZYMV coat protein specific primers: CP-forward (5'-GCTCCATACATAGCTGAGAC-3') and CP-reverse (5'-AACGGAGTCTAATCTCGAGC-3') targeting a 1100-bp sequence. PCR was also performed to identify a possible coinfection with other viruses, such as Watermelon mosaic virus, Cucumber mosaic virus, Papaya ring spot virus, and Squash mosaic virus in the same 60 pumpkin samples and also from 240 additional samples of squash (60 plants), watermelon (60 plants), cucumber (60 plants), and bitter gourd (60 plants). Amplification of a ZYMV-specific band was found in 96% of pumpkin (58 of 60 samples) and in 60% of squash (36 of 60 samples). Interestingly, we found coinfection of Squash mosaic virus(SqMV) in 56% of pumpkin (34 of 60 samples) and in 50% of watermelon samples (30 of 60 samples) by using primers SqMV RNA2 f1 (GGTGCAGCAGCTTGGAACTTATAATCCAATTTGG) and SqMV RNA2 r1 (TGGGAAAGAAGCCACAACAAAACCC) targeting a 582-bp nucleotide sequence. In addition, high populations of aphids (Aphis gossypii) were noticed in cucurbit fields of Trinidad. To confirm the transmission of ZYMV through aphid vectors, 10 sterile pumpkin seedlings were grown in green house. Pumpkin seedlings naturally infected with ZYMV and confirmed by PCR reactions were collected from a Barrackpore field and