First Report of Leaf blight of Poa pratensis Caused by Peyronellaea glomerata in China

A leaf blight disease of Poa pratensis was observed at Gansu Province, China, in July 2013. Initially, symptoms appeared on the tips and margin of the upper leaves of the grass, and then enlarged rapidly to produce yellow lesions that covered large areas of the leaf. In moist weather, gray moldy growth was present on the lesions. Numerous pycnidia were often observed within the diseased tissue. Six symptomatic leaves from six plants were collected and the diseased tissues were surface sterilized with 75% alcohol for 2 min, and then directly transferred to potato dextrose agar (PDA) medium. Ten fungal isolates (named HZ-1 to HZ-10) that varied in culture characteristic were obtained from the diseased samples. The pathogenicities of all 10 isolates were evaluated. For each isolate, five tubs of P. pratensis(approximately 50 P. pratensis plants per tub) were sprayed with a conidial suspension (10 super(6) cfu/ml) of the isolate. Control P. pratensis plants were sprayed with sterile water. The inoculated plants were kept in an incubator at 25[degrees]C for 48 h with relative humidity of 100%. Assays were repeated three times. Typical symptoms of the leaf blight disease were observed approximately 14 days after inoculation with the strain HZ-2. No symptoms were observed on the control plants and plants inoculated with the nine other isolates. Pycnidia of HZ-2 were recovered from the lesions of inoculated plants after 4 weeks and placed on PDA medium. The HZ-2 colonies were white initially, and then became olive green to dark brown. Concentric lines were visible on the back of medium. The mycelium was septate, and hyaline or light brown. Conidia were long, ellipsoid, single-celled, and hyaline with guttules on both sides. The size of the conidia ranged from 4.2 x 1.8 [mu]m to 7.7 x 4.8 [mu]m (avg. 5.8 x 3.4 [mu]m). Pycnidia were globose, ovoid or oblong, with an orifice, and ranged from 48.3 x 193.1 [mu]m to 38.5 x 139.6 [mu]m (avg. 106.0 x 86.4 [mu]m). The fungus shared morphological characteristics of Peyronellaea glomerata as described by Janke (1956) and Boerema et al. (1965, 1977). Genomic DNA was extracted with SK8259 column fungal genomic DNA extraction kit and ribosomal DNA was amplified with ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers. The nucleotide sequence of the 543-bp amplicon (GenBank Accession No. KT387236) was 99% identical to the ITS sequence from P. glomerata available from GenBank (AB470828). To our knowledge, this was