A deletion hot-spot in exon 7 of the G sub(s) alpha gene (GNAS1) in patients with Albright hereditary osteodystrophy

Albright hereditary osteodystrophy (AHO) is a familial disorder characterized by short stature, obesity, rounded facies and skeletal defects including brachydactyly and subcutaneous ossifications. Some affected patients have only the somatic features which are characteristic of the AHO phenotype [pseudopseudohypoparathyroidism (PPHP)] while others have these features in association with resistance to multiple hormones that are coupled to stimulation of adenylyl cyclase [pseudohypoparathyroidism (PHP)]. Molecular studies have identified heterozygous loss-of-function mutations in the gene which encodes the alpha -subunit of G sub(s) (GNAS1) in many AHO patients (both with PHP and PPHP). G sub(s) is the guanine nucleotide regulatory protein (G protein) which stimulates adenylyl cyclase. These mutations are consistent with the observations that most AHO patients have reduced steady-state levels of G sub(s) alpha mRNA and G sub(s) protein as measured by functional assays. GNAS1 is located on the distal long arm of chromosome 20 and contains 13 exons. The mutations identified to date include splice-junction and frameshift mutations as well as missense mutations which alter protein function. All of the GNAS1 mutations identified thus far have been found only in single independent AHO kindreds. We previously have identified a 4 bp deletion mutation in exon 7 of GNAS1 in lymphoblasts which were derived from an AHO patient and showed that the mutation disrupted mRNA expression. We now report that the identical mutation is present in four further unrelated AHO kindreds. Genomic DNA was isolated from blood using a previously described method or the IsoQuick kit. A 200 bp genomic DNA fragment including GNAS1 exon 7 was amplified using the following primers according to a previously published protocol: sense, 5' GCGGCCGCCCGTCCCGC CGCCCCCGCCCCGCCGCG GCCGCGCAAATTGATGTGAGCGCTGTG 3' (GC-clamp is underlined); antisense, 5' GTAGTTTGGAAAGAGGGCTCAG 3'. In each case the mutation was confirmed on at least two independent blood samples and control reactions with no DNA were run in all PCRs to rule out contamination. The identical heterozygous 4 bp deletion was found to be present in four further unrelated patients as determined by abnormal migration of the heteroduplexes in nondenaturing polyacrylamide gels, as previously described. In each case the mutation was confirmed by direct sequencing of the PCR products. The data on the four kindreds is summarized in Table 1.