Mutually Exclusive Interactions between Factors Binding to Adjacent Sp1 and AT-rich Elements Regulate Gastrin Gene Transcription in Insulinoma Cells

The gastrin gene is transiently expressed in fetal pancreatic islets during islet neogenesis but then switched off after birth when islet cells become fully differentiated. Previous studies identified a cis-regulatory sequence between −109 and −75 in the human gastrin promoter which binds islet cell-specific activators and a nonspecific repressor and thus may act as a molecular switch. The present study identified another cis-regulatory sequence (−163ACACTAAATGAAAGGGCGGGGCAG−140) which bound two islet nuclear proteins in a mutually exclusive manner, as defined by gel shift competition, methylation interference, and DNase I footprinting assays. The general transactivator Sp1 recognized the downstream GGGCGGGG sequence, but Sp1 binding was prevented when another islet factor bound to the adjacent AT-rich sequence (CTAAATGA). This gastrin AT-rich element is nearly identical to the binding site (ATAAATGA) for the islet-specific transcription factor βTF-1. However, the gastrin AT-binding factor appeared to differ from βTF-1 in its gel mobility shift pattern. Transfections of rat insulinoma cells revealed that mutations which blocked binding to the AT-rich element but allowed Sp1 binding up-regulated transcriptional activity. These results suggest that the gastrin AT-binding factor blocks transactivation by Sp1 and may have a role in the repression of gastrin transcription seen at the end of islet differentiation.