First report of Ethiopian tobacco bushy top virus and its associated satellite RNA in mixed infection with Potato virus Y infecting Solanum betacea in Kenya
The next generation sequencing (NGS) results were validated by RT-PCR with novel primers targeting a 789 bp fragment of the RNA-dependent RNA polymerase gene of ETBTV and another targeting a 405 bp fragment of the satRNA (Table 17). Symptoms observed on this farm included leaf vein clearing, curling...
Gespeichert in:
Veröffentlicht in: | New Disease Reports 2021-07, Vol.44 (1), p.n/a |
---|---|
Hauptverfasser: | , , , , |
Format: | Artikel |
Sprache: | eng |
Schlagworte: | |
Online-Zugang: | Volltext |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | The next generation sequencing (NGS) results were validated by RT-PCR with novel primers targeting a 789 bp fragment of the RNA-dependent RNA polymerase gene of ETBTV and another targeting a 405 bp fragment of the satRNA (Table 17). Symptoms observed on this farm included leaf vein clearing, curling and malformation (Fig 2). Because of the mixed infection with PVY, the symptoms could not be attributed solely to ETBTV and the satRNA. TABLE 1 Primers used in this study to detect Ethiopian tobacco bushy top virus (ETBTV) and Potato virus Y (PVY) Virus Target region Primer (5′ – 3′) Annealing temperature (°C) Expected size (bp) Reference ETBTV RdRp EV-F1 – CGCACATGATTGCCATGGAG EV-R1 – TTGTACAGTTTGCCCAACGC 55 789 This study ETBTV RNA satellite Partial SAT-F – GTGAAAACGTCACCCCAGC SAT-R – AGCACCGCCCTCACGG 55 405 This study PVY CP PVYF3 – CGTTGAAACCAATCGTTGAGAA PVYB3 – GACATCCTCGGTGGTGTG 45 331 Przewodowska, et al., 2015 FIGURE 2. |
---|---|
ISSN: | 2044-0588 2044-0588 |
DOI: | 10.1002/ndr2.12015 |