Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20ￂ bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of [beta]-Thalassemia in Mexican mestizo patients

Introduction Beta-thalassemia ([beta]-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. Methods One hundred and forty-nine [beta]-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for [delta][beta]-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. Results Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and [delta][beta]-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. Conclusion Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of [beta]-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans.