Regulation of Expression of the Human Interferon γ Gene

DNA fragments isolated from a genomic clone of human γ interferon (IFN-γ ) as well as IFN-γ cDNA were used to map potential regulatory regions of the IFN-γ gene by DNase I-hypersensitivity analyses. In nuclei from the human T-cell line Jurkat, which can be induced to express the IFN-γ gene, we observed a strongly hypersensitive site in the first intervening sequence that localized to the only intracistronic repeat element in the gene. DNase I mapping of Jurkat cells was compared to that of several other cell types, including B cells, macrophages, and epithelial cells. The presence of strong intronic hypersensitivity was found only in cells capable of expressing the IFN-γ gene. No hypersensitivity was found in the 3′regions of the gene. Further, no hypersensitivity was observed when purified genomic DNA from Jurkat was analyzed, suggesting that DNA-protein interactions, and not simply DNA sequence alone, were responsible for DNase I hypersensitivity. The sequence AAGTGTAATTTTTTGAGTTTCTTTT, which is directly in the intronic hypersensitive area of IFN-γ , is 83% homologous to a nearly identical sequence in the 5′flanking region of the interleukin 2 gene. In interleukin 2, the homologous sequence is about 300 base pairs upstream of that gene's promoter in an area of potential regulatory importance.