METHOD FOR THE DETERMINATION OF FRANCISELLA TULARENSIS SUBSPECIES BY MULTI-PRIMER PCR

FIELD: biotechnology.SUBSTANCE: invention relates to the field of biotechnology. A method for the determination of Francisella tularensis subspecies by the method of multi-primer PCR is described, including the isolation of DNA from the investigated strain of F. tularensis, PCR with specific primers and registration of the reaction using electrophoresis. The proposed method differs in that two common INDEL genes with deletions of a certain size, namely ft1779 and ft426, are detected on F. tularensis DNA, followed by their amplification using designed specific primers: to the ft1779 gene - primers GCCTTTTCAGTTCTTGAAATTGT and TTTGAGATTCGTGTAGTGTACTTGTG, with the amplified fragment length of 98 bps, or 107 bps, or 950 bps, to the ft426 gene - the primers GATTACACGACTACG, with the amplified fragment length of 98 bps, or 107 bps, or 950 bps, to the ft426 gene - the primers GATTACCACGACCTAG and the amplified fragment of 174 bps or 196 bps.EFFECT: invention expands the arsenal of methods for determining the subspecies of Francisella tularensis by multi-primer PCR.3 cl, 1 dwg, 1 tbl, 4 ex Изобретение относится к области биотехнологии. Описан способ определения подвидов Francisella tularensis методом мультипраймерной ПЦР, включающий выделение ДНК из исследуемого штамма F. tularensis, постановку ПЦР со специфическими праймерами и учет реакции с помощью электрофореза. Предложенный способ отличается тем, что на ДНК F. tularensis выявляют два общих INDEL-гена, имеющих делеции определенного размера, а именно ft1779 и ft426, с последующей их амплификацией с помощью сконструированных специфических праймеров: к гену ft1779 - праймеры GCCTTTTCAGTTCTTGAAATTGT и TTTGAGATTCGTGTAGTGTACTTGTG, с длиной амплифицированного фрагмента 98 п.н., или 107 п.н., или 950 п.н., к гену ft426 - праймеры GATAGACGCTGCATCGACAC и ACTAGAGTTAACCCATTCAACAAGA, с длиной амплифицированного фрагмента 174 п.н. или 196 п.н. Изобретение расширяет арсенал способов определения подвидов Francisella tularensis методом мультипраймерной ПЦР. 2 з.п. ф-лы, 1 ил., 1 табл., 4 пр.