METHOD FOR IDENTIFICATION OF DOMESTIC CAT TISSUE DNA (FELIS SILVESTRIS CATUS) IN DRY FODDERS AND SEMI-FINISHED MEAT PRODUCTS
FIELD: biotechnology.SUBSTANCE: invention relates to the field of biotechnology. Invention is a method for identification of domestic cat tissue DNA (Félis silvéstris cátus) in dry fodder and semi-finished meat products, involving extraction of DNA from animal tissue by sorption method, polymerase c...
Gespeichert in:
Hauptverfasser: | , , , , , , , , , , , , , , , |
---|---|
Format: | Patent |
Sprache: | eng ; rus |
Schlagworte: | |
Online-Zugang: | Volltext bestellen |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | FIELD: biotechnology.SUBSTANCE: invention relates to the field of biotechnology. Invention is a method for identification of domestic cat tissue DNA (Félis silvéstris cátus) in dry fodder and semi-finished meat products, involving extraction of DNA from animal tissue by sorption method, polymerase chain reaction with fluorescent detection is carried out with 45 cycles of real-time amplification using oligonucleotide primers, probes, fluorescent dyes specific for the DNA genome region: for specific signal for animal - JOE/Yellow and Cy5/Red - for internal control sample in form of suspension of bacteriophage T4 with concentration of 5 × 10phage particles per 1 mcl, a positive control sample in the form of a mixture containing fragments of animal genomes and bacteriophage T4 with a nucleotide sequence: T4F TACATATAAATCACGCAAAGC T4R TAGTATGGCTAATCTTATTGG T4P CY5 ACATTGGCACTGACCGAGTTC, taken in ratio of 1:1 and measuring accumulation of fluorescent signals through channels of corresponding fluorescent dyes, performing interpretation of results based on presence or absence of intersection of fluorescence curve with threshold line, if fluorescence signal accumulation curves are up to 35 cycles, the reaction result is considered to be positive, and if the curves do not cross the threshold line or cross it after 35 cycles, the result of the reaction is negative, according to the invention, DNA is recovered from domestic cat tissue (Félis silvéstris cátus) and the internal control sample is phagolysate of bacteriophage T4, and for a positive control sample - fragments of genomes of native bacteriophage T4 and domestic cat tissue (Félis silvéstris cátus) with the following nucleotide sequence: Félis F ATTCggCCTACATCCgTgAC forward primer Félis R AgAAgACCCCTgCTACgACT reverse primer Félis P R6G-CTTgAgTggAgTAgggCgg-BHQ1 probe.EFFECT: invention makes it possible to increase accuracy of cat tissue species identification, to simplify sample preparation process.1 cl, 5 tbl
Изобретение относится к области биотехнологии. Изобретение представляет собой способ идентификации ДНК ткани кошки домашнейв сухих кормах и мясных полуфабрикатах, включающем выделение ДНК из ткани животного сорбционным методом, постановку полимеразной цепной реакции с флуоресцентной детекцией с проведением 45 циклов амплификации в реальном времени с использованием специфичных для участка генома ДНК животного олигонуклеотидных праймеров, зондов, флуоресцентных красителей: для специфического сигнала для жив |
---|