METHOD FOR DIFFERENTIATION OF HELICOBACTER PYLORI STRAINS BY MOLECULAR-GENETIC TYPING

FIELD: microbiology.SUBSTANCE: invention refers to medical microbiology, namely to methods of molecular-genetic typing strains of infectious agents that are used in microbiological and molecular-genetic monitoring of H.pylori strains circulating in various territories for their differentiation. From...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Hauptverfasser: Sorokin Vladimir Mikhajlovich, Vodopyanov Aleksej Sergeevich, Pisanov Ruslan Vyacheslavovich
Format: Patent
Sprache:eng ; rus
Schlagworte:
Online-Zugang:Volltext bestellen
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
Beschreibung
Zusammenfassung:FIELD: microbiology.SUBSTANCE: invention refers to medical microbiology, namely to methods of molecular-genetic typing strains of infectious agents that are used in microbiological and molecular-genetic monitoring of H.pylori strains circulating in various territories for their differentiation. From the H. pylori DNA of the analyzed sample, five general INDEL-genes are detected, having deletions of a certain size, namely IND-3330, 5605, 6405, 340 and 1390, with their subsequent amplification using the engineered specific primers detecting two alternative alleles: to IND-3330 gene - primers AATGTTTGCATGGGCAAAAG and GAATAGCGTTTAGAGGGCGTTA, with length of amplified fragment 60 bp or 69 bp, to IND-5605 gene - primers AGGGAAGTGAGCGAAGAAGA and ACAGCCCCCACCTTTCTTT, with length of amplified fragment 93 bp or 102 bp, to IND-6405 gene - primers ATTATTTCCGTTGGCTCGTG and GCATAAATGGGCATGGTAGC, with length of amplified fragment 100 bp or 106 bp to IND-340 gene - primers CCCCAAAAACTCCAAAGACA and AACACCGCATCATTGACTTG, with length of amplified fragment 79 bp or 85 bp, to IND-13 90 gene - primers CGCTCCTATCTCATGCCCTA and GATCTCGAGCTTAAGCCCTCT, with length of amplified fragment 64 bp or 76 bp, wherein the differentiation results are recorded visually after electrophoresis in 8 % polyacrylamide gel in the presence of a DNA molecular weight marker, wherein for each strain a unique INDEL-genotype is established on five INDEL-genes, and by comparing the detected INDEL-genotypes between each other and with known genotypes of the identification table, the common or different origin of the investigated H. pylori strains is stated. PCR is carried out in volume of 25 mcl and the reaction mixture contains: 1.5 mM Mg-buffer, 0.2 mM dNTP mix, 1.0 mcM primer mix (0.5 mM of each primer), 25 ng DNA-matrix, 1 unit of DNA polymerase, the remaining volume is water, wherein the matrix used is genomic DNA, 5 mcl, which is obtained from different H. pylori strains. PCR is carried out with following modes: stage 1 - denaturation at 95 °C - 3 min (1 cycle); stage 2 - denaturation at 95 °C - 20 s, annealing at 55 °C - 20 s, synthesis at 72 °C - 20 s (35 cycles); stage 3 - pre-synthesis at 72°C is 7 minutes (1 cycle).EFFECT: method enables reliable and rapid differentiation of one strain from another and determining their origin.3 cl, 2 dwg, 3 tbl, 4 ex Изобретение относится к области медицинской микробиологии, а именно к способам молекулярно-генетического типирования штаммов возбудителей инфекционн