METHOD FOR DIAGNOSING HAND AND FOOT ONYCHOMYCOSIS LESION
FIELD: medicine. ^ SUBSTANCE: method involves identifying Trichophyton rubrum by applying polymerase chain reaction of DNA separated from skin or nail plate sample incubated in 2-4 M alkaline solution for at least 1 h at 50-65C. The solution is neutralized with 30% HCl acid, the sample is resediment...
Gespeichert in:
Hauptverfasser: | , , , , , |
---|---|
Format: | Patent |
Sprache: | eng ; rus |
Schlagworte: | |
Online-Zugang: | Volltext bestellen |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | FIELD: medicine. ^ SUBSTANCE: method involves identifying Trichophyton rubrum by applying polymerase chain reaction of DNA separated from skin or nail plate sample incubated in 2-4 M alkaline solution for at least 1 h at 50-65C. The solution is neutralized with 30% HCl acid, the sample is resedimented in 50% ethanol solution at -10 - -20C and dried at 50-65C. The DNA polymerase chain reaction is carried out with synthetic DNA-probes having sequence of TR-1-F (sense): 5'atcgaatctttgaacgcaca'; TR-1-F (antisense): 5'tataaagattggggccaggg 3' highly specific for gene 28 S Trichophyton rubrum RNA. The result being positive, onychomycosis is diagnosed caused by Trichophyton rubrum fungus. ^ EFFECT: high specificity of diagnosis method. ^ 2 dwg, 1 tbl |
---|