Método para el salto eficaz del exón (44) en la distrofia muscular de Duchenne y medios asociados

Oligonucleótido antisentido que consiste en la secuencia de 5' ucagcuucuguuagccacug 3' (SEQ ID Nº: 5) donde al menos uno de los nucleótidos es un análogo de nucleótido. The invention relates to a nucleic acid molecule that binds and/or is complementary to the nucleotide molecule having seq...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Hauptverfasser: van Deutekom, Judith Christina Theodora, Platenburg, Gerard Johannes, van Ommen, Garrit-Jan Boudewijn, de Kimpe, Josephus Johannes, Aartsma-Rus, Annemieke
Format: Patent
Sprache:spa
Schlagworte:
Online-Zugang:Volltext bestellen
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
Beschreibung
Zusammenfassung:Oligonucleótido antisentido que consiste en la secuencia de 5' ucagcuucuguuagccacug 3' (SEQ ID Nº: 5) donde al menos uno de los nucleótidos es un análogo de nucleótido. The invention relates to a nucleic acid molecule that binds and/or is complementary to the nucleotide molecule having sequence 5'-GUGGCUAACAGAAGCU (SEQ ID NO 1) and to its use in a method for inducing skipping of exon 44 of the DMD gene in a DMD patient.