Método para el salto eficaz del exón (44) en la distrofia muscular de Duchenne y medios asociados
Oligonucleótido antisentido que consiste en la secuencia de 5' ucagcuucuguuagccacug 3' (SEQ ID Nº: 5) donde al menos uno de los nucleótidos es un análogo de nucleótido. The invention relates to a nucleic acid molecule that binds and/or is complementary to the nucleotide molecule having seq...
Gespeichert in:
Hauptverfasser: | , , , , |
---|---|
Format: | Patent |
Sprache: | spa |
Schlagworte: | |
Online-Zugang: | Volltext bestellen |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | Oligonucleótido antisentido que consiste en la secuencia de 5' ucagcuucuguuagccacug 3' (SEQ ID Nº: 5) donde al menos uno de los nucleótidos es un análogo de nucleótido.
The invention relates to a nucleic acid molecule that binds and/or is complementary to the nucleotide molecule having sequence 5'-GUGGCUAACAGAAGCU (SEQ ID NO 1) and to its use in a method for inducing skipping of exon 44 of the DMD gene in a DMD patient. |
---|