COMPOUNDS FOR THE TREATMENT OF INFLAMMATORY BOWEL DISEASE
The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence AAAAGCUGGGUUGAGAGGGCGA; (b) a second part capable of forming a loop between the first and the...
Gespeichert in:
Hauptverfasser: | , , |
---|---|
Format: | Patent |
Sprache: | eng ; fre ; ger |
Schlagworte: | |
Online-Zugang: | Volltext bestellen |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence AAAAGCUGGGUUGAGAGGGCGA; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence AAAAGCUGGGUUGAGAGGGCGA; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence AAAAGCUGGGUUGAGAGGGCGA, for use as a medicament. In another aspect, the present invention relates to a composition comprising at least one mature miRNA selected from the group consisting of hsa-miR-320a, ptr-miR-320a, ppy-miR-320a, bta-miR-320, cfa-miR-320, mmu-miR-320, rno-miR-320, and mml-miR-320, and/or one or more mir-RNA precursor(s) thereof, for use as a medicament. |
---|