New nucleotide sequences for the cell cycle regulated expression of structural genes
The invention refers to a nucleic acid construct comprising: a) at least one activator sequence b) at least one promotor module comprising a nucleotide sequence which binds a protein of the E2F family and a protein of the CDF-1 family c) at least one structural gene, wherein said promotor module, co...
Gespeichert in:
Hauptverfasser: | , , , |
---|---|
Format: | Patent |
Sprache: | eng ; fre ; ger |
Schlagworte: | |
Online-Zugang: | Volltext bestellen |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | The invention refers to a nucleic acid construct comprising: a) at least one activator sequence b) at least one promotor module comprising a nucleotide sequence which binds a protein of the E2F family and a protein of the CDF-1 family c) at least one structural gene, wherein said promotor module, comprises at least one nucleotide sequence which is selected from the group consisting of ACTTGGCGGGAGATTTGAAT and GCTTGGCGGGAGGTTTGAAT, a process for the preparation of a pharmaceutical containing said nucleic acid construct for use in treatment of a tumor disease and the protein CDF-1 and its use for the search of modulations of its repressor function. |
---|