NOVEL DETECTION METHODS FOR CRYPTOSPORIDIUM
PCT No. PCT/AU96/00387 Sec. 371 Date Mar. 20, 1998 Sec. 102(e) Date Mar. 20, 1998 PCT Filed Jun. 25, 1996 PCT Pub. No. WO97/02281 PCT Pub. Date Jan. 23, 1997The invention provides a purified and isolated Cryptosporidium DNA sequence comprising the nucleotide sequence: GATGGTACTGGATAGATAGTGGAAGTCCCGT...
Gespeichert in:
Hauptverfasser: | , |
---|---|
Format: | Patent |
Sprache: | eng ; fre ; ger |
Schlagworte: | |
Online-Zugang: | Volltext bestellen |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | PCT No. PCT/AU96/00387 Sec. 371 Date Mar. 20, 1998 Sec. 102(e) Date Mar. 20, 1998 PCT Filed Jun. 25, 1996 PCT Pub. No. WO97/02281 PCT Pub. Date Jan. 23, 1997The invention provides a purified and isolated Cryptosporidium DNA sequence comprising the nucleotide sequence: GATGGTACTGGATAGATAGTGGAAGTCCCGTATCAGTTCGAGATTCTGAAATTA ATTGGACATCAAGTTATAAAGCAAGCTGGTTATTAAGATTCAAATTTCCCTTTGA AAAGTGTGGCTTTTTTGATATTGGAGGGTTAGGAAGAAGGTT plus methods and kits for detecting and/or identifying the presence of Cryptosporidium. |
---|