RECOMBINANT PLASMID DNAS, CODING FOR SYNTHESIS OF POLYPEPTIDE SUBSTANCES FOR A VACCINE AGAINST HEPATITIS A

Recombinant plasmid DNAs, coding for synthesis of polypeptide substances for a vaccine against hepatitis A, consist of a fragment of the HAV genome and an expressing vector. As the fragment of the HAV genome are used: a fragment of the size 389 b.p., coding for the VP1 protein fragment from 4 to 129 a.a.; a fragment of the size 3372 b.p., coding for all structured VP4 proteins starting with 38 a.a., and for all non-structured HAV proteins; a fragment of the size 1243 b.p., coding for a polypeptide chain containing the VP3 protein fragments from 110 to 233 a.a. and the VP1 protein fragments from 1 to 271 a.a; a fragment of the size 144 b.p., coding for the VP1 protein from 4 to 57 a.a.; a synthetic fragment of DNA, coding for the VP1 protein fragment from 11 to 25 a.a. having the following structure: AATTCACAGTTAGTACTGAACAAAATGTACCAGATCCACAGGTAGGTATTGCGGTGTCAATCATGACTTG TTTTACATGGTCTAGGTGTCCATCCATA or a fragment of the size 4296 b.p. consisting of a fragment of the size 3372 b.p., coding for all the structured and some non-structured HAV proteins, and of a fragment of the size 924 b.p., coding for the viral protease. As the expressing vector are used: plasmid pUR 291, pUR 292, pIFN-fu1, pIFN-fu2 or plasmid pSPVV inserted in vaccinia virus LIVP as vector. Des ADNs à plasmides recombinants, codant pour la synthèse de subtances polypeptides pour un vaccin contre l'hépatite A, sont constitués d'un fragment du génome HAV, et d'un vecteur d'expression. On utilise comme fragment du génome HAV: un fragment de la dimension 389 b.p., codant pour le fragment de protéine VP1 de 4 à 129 a.a.; un fragment de la dimension 3372 b.p., codant pour toutes les protéines structurées VP4 en partant de 38 a.a., et pour toutes les protéines HAV non structurées; un fragment de la dimension 1243 b.p., codant pour une chaîne polypeptides contenant les fragments de protéine VP3 de 110 à 233 a.a. et le fragment de protéine VP1 de 1 à 271 a.a.; un fragment de la dimension 144 b.p., codant pour la protéine VP1 de 4 à 57 a.a.; un fragment synthétique de ADN, codant pour le fragment de protéine VP1 de 11 à 25 a.a. ayant la structure suivante: AATTCACAGTTAGTACTGAACAAAATGTACCAGATCCACAGGTAGGTATTGCGGTGTCAATCATGACTTGTTTTACATGGTCTAGGTGTCCATCCATA ou bien un fragment 4296 b.p., codant pour toutes les protéines HAV structurées et pour certaines non structurées, et d'un fragment de la dimension 424 b.p., codant pour la protéase virale. On utilise comme vecteur d'expression: le plasmide pUR 291, pUR