New primers and probes from the factor V gene, useful for detecting the mutation that causes activated protein C resistance

Primers (I) derived from the factor V gene are new. (I) have formulae (1), specific for the G to A mutation at position 1691 in exon 10; (2), specific for the wild-type sequence and (3), a reverse primer for use with both (1) and (2): (1) ACA4TACCTGTATTCCAT; (2) ACA4TACCTGTATTCCGC; (3) TCATGAAATAACTTTGCAAATGA . Independent claims are also included for the following: (1) oligonucleotide probes (II) of formulae (4)-(7): (a) TACTTATAAGTGGAACATCTTAGAGTTTGATGAACC; (b) TGCCCAGTGCTTAACAAGACCATACTACAGTGACGT ; (c) UACUUAUAAGUGGAACAUCUUAGAGUUUGAUGAACC; (d) UACUUAUAAGUGGAACAUCUUAGAGUUUGA; (2) sets of primers comprising (3) plus (1) or (2); (3) a method for detecting factor V gene sequences by amplifying sample DNA with both primer sets of (b) and evaluating amplification; and (4) a test kit for detecting APC (activated protein C)-resistance mutations comprising one or more (I) and optionally one or more (II). Die vorliegende Erfindung betrifft einen automatisierbaren Gentest zum Nachweis des Thromboserisikofaktors APC (aktiviertes Protein C), geeignete Starteroligonukleotide, Oligonukleotidsonden für diesen Gentest, sowie ein Verfahren und ein Testteil zum Nachweis der APC Resistenz-Mutation.