New oligonucleotide, comprising specified sequences, is argonaute-4 expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis

Oligonucleotide, comprising one or more sequences comprising SEQ ID NOs: 1-6, is new. Oligonucleotide, comprising one or more sequences including caggcaaagattggaaaggg (SEQ ID NO: 1), caagttttgcatttatcttc (SEQ ID NO: 2), tgcaagtagtcgtgtgagtt (SEQ ID NO: 3), aatttgtactgcaagtagtc (SEQ ID NO: 4), gtttatgagatttggaccgt (SEQ ID NO: 5) or gagaaggctagtttatgaga (SEQ ID NO: 6), is new. Independent claims are included for: (1) a vector comprising the oligonucleotide; (2) a nucleic acid construct comprising the oligonucleotide and a detectable marker; (3) a composition comprising the oligonucleotide, optionally in conjunction with one or more adjuvants, diluents and/or carriers; (4) a diagnostic composition comprising the oligonucleotide or the nucleic acid construct; (5) specifically inhibiting the expression of ago-4 in a cell in vitro, comprising introducing the oligonucleotide or the vector in the cell, and providing suitable hybridization conditions; and (6) detecting ago-4 mRNA in a cell in vitro, comprising introducing the nucleic acid construct in a cell, providing the suitable hybridization conditions and detecting the detectable marker. ACTIVITY : Angiogenesis Inhibitor; Antianemic; Anticonvulsant; Nootropic; Cytostatic. MECHANISM OF ACTION : Ago-4 expression inhibitor. The ability of the oligonucleotide to inhibit human Ago-4 mRNA expression was tested in vitro in ECV304 cells. The result showed that the as4510/20 (SEQ ID NO: 5) exhibited an IC 50value of 10 nM. Die vorliegende Erfindung betrifft Oligonukleotide, die spezifisch an das Protein Argonaute-4 (Ago-4) kodierende mRNA hybridisieren können. Mit Hilfe dieser Oligonukleotide kann die Expression von Ago-4 gehemmt und Ago-4 mRNA nachgewiesen werden. Die vorliegende Erfindung betrifft weiter diese Oligonukleotide enthaltende pharmazeutische Zusammensetzungen, Verfahren zur spezifischen Hemmung der Argo-4 Expression und zum Nachweis von Ago-4 mRNA sowie die Verwendung dieser Oligonukleotide zur Hemmung und Expression von Ago-4 in einer Zelle.