Detection and differentiation of Salmonella serovars, especially parathyphi B and Java, useful for analysis of e.g. food, clinical and water samples, based on amplification of gene STM3356

Method for detecting and/or differentiating Salmonella serovars (A). Method for detecting and/or differentiating Salmonella serovars (A) comprises (i) amplifying a region of the STM3356 gene, using a primer that hybridizes specifically to this gene; (ii) hybridizing a first oligonucleotide (ON1), containing at least 18 consecutive nucleotides (nt) of Seq. (1), or its complement, or of a sequence (or complement) that differs from Seq. (1) by up to 3 deletions, additions and/or substitutions, where ON1 hybridizes specifically to one region of the gene and includes at least Seq. (2), or its complement, to the amplified gene region; and (iii) hybridizing a second oligonucleotide (ON2) containing at least 18 consecutive nt of Seq. (3), or its complement, or of a sequence (or complement) that differs from Seq. (3) by up to 3 deletions, additions and/or substitutions, where ON2 hybridizes specifically to a region of the same gene and includes at least Seq. (4), or its complement, to the amplified gene region; where this amplified region includes at least Seq. (2) and (4). 5'-CGCGATCTGGATAATTATAAATATAGAACCCATTACCCTTACCGATCGCG Seq. (1) 5'-TATAGAACC Seq. (2) 5'-CGCGATCTGGATAATTATAAATATGGAACCCATTACCCTTACCGATCGCG Seq. (3) 5'-TATGGAACC Seq. (4) Independent claims are included for the following: (1) similar process but based on amplification of one region from the sopE1 gene and a second region from the avrA gene, and detection of amplicons using oligonucleotide probes that contain at least 18 consecutive nt of Seq. (7) and Seq. (8), their complements or sequences that differ by up to 3 deletions, additions and/or substitutions; (2) biochip for the new method; (3) oligonucleotides that hybridize specifically with the STM3356, spoE1 and avrA genes, containing at least 15 consecutive nt from any of Seq. (1), (3), (5), (7)-(12), or their complements or sequences that differ by 1-3 deletions, additions and/or substitutions; and (4) kit for the new process that contains at least ON1 and ON2. 5'-AATTTCTCCCTGTCAACATTGG Seq. (5) 5'-CCCATACAAACATGACGATAGC Seq. (6) 5'-CGCGATCACCGAGGAAGCGCATCTTCGCG Seq. (7) 5'-CGCGATCCTGGATTCATATCAGTTACGAGGAAGATCGCG Seq. (8) 5'-TTTAACGACTTTATTTGTCAACACT Seq. (9) 5'-TTTATTTCGCATAAGAACACTGG Seq. (10) 5'-CTGTATTGTTGAGCGTCTGG Seq. (11) 5'-ATTTAACTCTGGATACTTCTTATTGG Seq. (12). Die Erfindung betrifft ein Verfahren zum labordiagnostischen Nachweis und zur Unterscheidung von Salmonella-Serovaren, insbesondere zur Unterscheidung von Salmonella enterica sub