Angiostrongylus cantonensis microdroplet digital PCR rapid detection method

The invention provides a Angiostrongylus cantonensis microdroplet digital PCR (polymerase chain reaction) rapid detection method, which comprises the following steps of: 1, preparing DNA (deoxyribonucleic acid) of an insect body to be detected, and preparing a digital PCR specific primer; the digital PCR specific primer is synthesized by selecting a specific gene sequence of Angiostrongylus cantonensis, and comprises an upstream primer, a downstream primer, an upstream primer, a downstream primer and a downstream primer, wherein the upstream primer is TAATGGTGCGGCGATTTGTT; the downstream primer is GACAACGAGTGACATACGCC, and the downstream primer is The probe is ATGCCACCTGAATTGCTGG, and the probe is 2, performing PCR amplification on the to-be-detected polypide DNA by adopting a digital PCR reaction system, and detecting an amplification product to obtain a detection result; wherein the digital PCR reaction system comprises a digital PCR specific primer. The method can be used for absolute quantitative detectio