PCR (Polymerase Chain Reaction) kit for detecting mycoplasma pollution in cell culture and application of PCR kit

The invention provides a PCR (Polymerase Chain Reaction) kit for detecting mycoplasma pollution in cell culture and application of the PCR kit. The composition disclosed by the invention comprises the following sequences: (1) an upstream primer Primer-Myc-F: TGAGTAGTATGCTCGCAAGAGTG, (2) an upstream...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
1. Verfasser: ZHAO XIANKUN
Format: Patent
Sprache:chi ; eng
Schlagworte:
Online-Zugang:Volltext bestellen
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
Beschreibung
Zusammenfassung:The invention provides a PCR (Polymerase Chain Reaction) kit for detecting mycoplasma pollution in cell culture and application of the PCR kit. The composition disclosed by the invention comprises the following sequences: (1) an upstream primer Primer-Myc-F: TGAGTAGTATGCTCGCAAGAGTG, (2) an upstream primer, (3) a downstream primer, (4) an upstream primer and (5) a downstream primer, wherein the upstream primer is used for PCR (Polymerase Chain Reaction) amplification of a mycoplasma nucleic acid sequence; and (2) a downstream primer Primer-Myc-R: CGACACGAGCTGACGACAAC, which is used for carrying out PCR (Polymerase Chain Reaction) amplification on the nucleic acid sequence of the mycoplasma. The composition can be used for preparing a PCR kit. The composition or the kit can be used for mycoplasma detection. Compared with the existing PCR (Polymerase Chain Reaction) primer amplification method, the primer pair disclosed by the invention is optimized, so that Primer-BLAST shows that 528 products can be amplified,