Species-specific polymerase chain reaction (SS-PCR) specific primers and kit for fast identification of Bactrocera rubigina
The invention belongs to the field of quarantine insect detection and relates to species-specific polymerase chain reaction (SS-PCR) specific primers and a kit for fast identification of Bactrocera rubigina. The SS-PCR specific primer pair comprises XF29: 5'GTAGGAACTTCGCTTAGAATTTTAG3' and...
Gespeichert in:
Hauptverfasser: | , , , , , |
---|---|
Format: | Patent |
Sprache: | eng |
Schlagworte: | |
Online-Zugang: | Volltext bestellen |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | The invention belongs to the field of quarantine insect detection and relates to species-specific polymerase chain reaction (SS-PCR) specific primers and a kit for fast identification of Bactrocera rubigina. The SS-PCR specific primer pair comprises XF29: 5'GTAGGAACTTCGCTTAGAATTTTAG3' and XR293: 5'GACTTCTTACTAATAGAAGCGTGA3'. The method for fast identification of Bactrocera rubigina by SS-PCR has the advantages of simple processes, high specificity and high sensitivity, can realize identification of Bactrocera rubigina in 8h and can satisfy port fast inspection and quarantine requirements. |
---|