SS-PCR (sequence specific primers-polymerase chain reaction) specific primers and kit for quickly identifying pumpkin fruit-fly
The invention relates to the field of quarantine pest detection, particularly an SS-PCR (sequence specific primers-polymerase chain reaction) specific primer pair and kit for quickly identifying pumpkin fruit-fly. The primer pair comprises a primer NF404: TGCCTTAGCGATATTCTGGCT and a primer NR610:AAC...
Gespeichert in:
Hauptverfasser: | , , , , , |
---|---|
Format: | Patent |
Sprache: | eng |
Schlagworte: | |
Online-Zugang: | Volltext bestellen |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | The invention relates to the field of quarantine pest detection, particularly an SS-PCR (sequence specific primers-polymerase chain reaction) specific primer pair and kit for quickly identifying pumpkin fruit-fly. The primer pair comprises a primer NF404: TGCCTTAGCGATATTCTGGCT and a primer NR610:AACTGTGTTCAGCAGGTGGT. The SS-PCR method for quickly identifying pumpkin fruit-fly is quick and simple, has the advantages of high specificity, high sensitivity and the like, can complete pumpkin fruit-fly identification within 8 hours, and can satisfy the requirements for seaport inspection/quarantine quick clearance. |
---|