Reagent for detecting enterohemorrhagic escherichia coli by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for enterohemorrhagic escherichia coli
The invention discloses a reagent for detecting enterohemorrhagic escherichia coli by using a cross primer nucleic acid isothermal amplification technology, an amplification method and a detection method for enterohemorrhagic escherichia coli. Five primer group sequences are designed, namely 5'...
Gespeichert in:
Hauptverfasser: | , , , , , , , , , , , , , , , , |
---|---|
Format: | Patent |
Sprache: | chi ; eng |
Schlagworte: | |
Online-Zugang: | Volltext bestellen |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | The invention discloses a reagent for detecting enterohemorrhagic escherichia coli by using a cross primer nucleic acid isothermal amplification technology, an amplification method and a detection method for enterohemorrhagic escherichia coli. Five primer group sequences are designed, namely 5'CAGTCGTACGGGGATGCAG, 5'TCAGCAGTCATTACATAAG, 5'GCTCTTGCCACAGACTGCGTC, 5'AGGTTCCGCTATGCGACAT and 5'GCTCTTGCCACAGACTGCGTCAGTTTCGCCATTCGTTGACTACTT. Aiming at the enterohemorrhagic escherichia coli O157:H7 bacteria, the defects in the prior art are overcome by the reagent, and a method for detecting the enterohemorrhagic escherichia coli quickly at low cost by using the cross primer nucleic acid isothermal amplification technology is provided. |
---|