Construção de ácido nucléico para a expressão regulada pelo ciclo celular de genes estruturais

Patente de Invenção:"CONSTRUçãO DE AçIDO NUCLéICO PARA A EXPRESSãO REGULADA PELO CICLO CELULAR DE GENES ESTRUTURAIS". A invenção refere-se à uma construção de ácido nucléico compreendendo pelo menos uma seq³ência ativadora, pelo menos um módulo promotor quimérico compreendendo uma seq³ênci...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Hauptverfasser: ROLF MUELLER, NINGSHU LIU, HANS-HARALD SEDLACEK, JOERK ZWICKER
Format: Patent
Sprache:por
Schlagworte:
Online-Zugang:Volltext bestellen
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
Beschreibung
Zusammenfassung:Patente de Invenção:"CONSTRUçãO DE AçIDO NUCLéICO PARA A EXPRESSãO REGULADA PELO CICLO CELULAR DE GENES ESTRUTURAIS". A invenção refere-se à uma construção de ácido nucléico compreendendo pelo menos uma seq³ência ativadora, pelo menos um módulo promotor quimérico compreendendo uma seq³ência de nucleotídeos, a qual liga uma proteína da família de E2F e uma proteína da família de CDF-1, e pelo menos um gene estrutural, onde o dito módulo promotor quimérico causa uma regulação completa da expressão do gene no ciclo celular mais tarde do que o promotor B-myb, porém mais cedo do que o promotor cdc25C, e à proteína CDF-1. The invention refers to a nucleic acid construct comprising: a) at least one activator sequence b) at least one promotor module comprising a nucleotide sequence which binds a protein of the E2F family and a protein of the CDF-1 family c) at least one structural gene, wherein said promotor module, comprises at least one nucleotide sequence which is selected from the group consisting of ACTTGGCGGGAGATTTGAAT and GCTTGGCGGGAGGTTTGAAT, a process for the preparation of a pharmaceutical containing said nucleic acid construct for use in treatment of a tumor disease and the protein CDF-1 and its use for the search of modulations of its repressor function.