Construção de ácido nucléico para a expressão regulada pelo ciclo celular de genes estruturais
Patente de Invenção:"CONSTRUçãO DE AçIDO NUCLéICO PARA A EXPRESSãO REGULADA PELO CICLO CELULAR DE GENES ESTRUTURAIS". A invenção refere-se à uma construção de ácido nucléico compreendendo pelo menos uma seq³ência ativadora, pelo menos um módulo promotor quimérico compreendendo uma seq³ênci...
Gespeichert in:
Hauptverfasser: | , , , |
---|---|
Format: | Patent |
Sprache: | por |
Schlagworte: | |
Online-Zugang: | Volltext bestellen |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | Patente de Invenção:"CONSTRUçãO DE AçIDO NUCLéICO PARA A EXPRESSãO REGULADA PELO CICLO CELULAR DE GENES ESTRUTURAIS". A invenção refere-se à uma construção de ácido nucléico compreendendo pelo menos uma seq³ência ativadora, pelo menos um módulo promotor quimérico compreendendo uma seq³ência de nucleotídeos, a qual liga uma proteína da família de E2F e uma proteína da família de CDF-1, e pelo menos um gene estrutural, onde o dito módulo promotor quimérico causa uma regulação completa da expressão do gene no ciclo celular mais tarde do que o promotor B-myb, porém mais cedo do que o promotor cdc25C, e à proteína CDF-1.
The invention refers to a nucleic acid construct comprising: a) at least one activator sequence b) at least one promotor module comprising a nucleotide sequence which binds a protein of the E2F family and a protein of the CDF-1 family c) at least one structural gene, wherein said promotor module, comprises at least one nucleotide sequence which is selected from the group consisting of ACTTGGCGGGAGATTTGAAT and GCTTGGCGGGAGGTTTGAAT, a process for the preparation of a pharmaceutical containing said nucleic acid construct for use in treatment of a tumor disease and the protein CDF-1 and its use for the search of modulations of its repressor function. |
---|