CRISPR/Cpf1 systems and methods
"TTN" PAM Site Protospacer domain target binding site 5' -AAATTTAGGAAA ATTTTA HumanGenomicDNA HPRT1 i8595 Site TTTTAAATCCTTTCTCTTAACAAAAGAGGAAGGTCGT'GA ' uguagauggaaagagaauuguuuucuccuuc 3' u AsCpf1crRNA 0 ucaucuuuaau' This invention pertains to recombinant AsCPfl n...
Gespeichert in:
Hauptverfasser: | , , , |
---|---|
Format: | Patent |
Sprache: | eng |
Schlagworte: | |
Online-Zugang: | Volltext bestellen |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | "TTN" PAM Site Protospacer domain target binding site 5' -AAATTTAGGAAA ATTTTA HumanGenomicDNA HPRT1 i8595 Site TTTTAAATCCTTTCTCTTAACAAAAGAGGAAGGTCGT'GA ' uguagauggaaagagaauuguuuucuccuuc 3' u AsCpf1crRNA 0 ucaucuuuaau' This invention pertains to recombinant AsCPfl nucleic acids and polypeptides for use in CRISPR/ Cpfl endonuclease sysems and mammalian cell lines encloding recombinant AsCpflor LbCpfl polypeptides. The invention includes recombinant ribonucleoprotein compleses and CRISPR/Cpfl endonuclease systems having a sjuitable AsCpfl or crRNA is selected from a length-truncated AsCpfl crRNA, a chemically modified AsCPfl crRNA, or an AsCpfl CrRNA comprising both length truncations and chemical modifications. Methods of performing gene editing using these system and reagents are also provided. |
---|