CRISPR/Cpf1 systems and methods

"TTN" PAM Site Protospacer domain target binding site 5' -AAATTTAGGAAA ATTTTA HumanGenomicDNA HPRT1 i8595 Site TTTTAAATCCTTTCTCTTAACAAAAGAGGAAGGTCGT'GA ' uguagauggaaagagaauuguuuucuccuuc 3' u AsCpf1crRNA 0 ucaucuuuaau' This invention pertains to recombinant AsCPfl n...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Hauptverfasser: COLLINGWOOD, Michael Allen, VAKULSKAS, Christopher Anthony, TURK, Rolf, BEHLKE, Mark Aaron
Format: Patent
Sprache:eng
Schlagworte:
Online-Zugang:Volltext bestellen
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
Beschreibung
Zusammenfassung:"TTN" PAM Site Protospacer domain target binding site 5' -AAATTTAGGAAA ATTTTA HumanGenomicDNA HPRT1 i8595 Site TTTTAAATCCTTTCTCTTAACAAAAGAGGAAGGTCGT'GA ' uguagauggaaagagaauuguuuucuccuuc 3' u AsCpf1crRNA 0 ucaucuuuaau' This invention pertains to recombinant AsCPfl nucleic acids and polypeptides for use in CRISPR/ Cpfl endonuclease sysems and mammalian cell lines encloding recombinant AsCpflor LbCpfl polypeptides. The invention includes recombinant ribonucleoprotein compleses and CRISPR/Cpfl endonuclease systems having a sjuitable AsCpfl or crRNA is selected from a length-truncated AsCpfl crRNA, a chemically modified AsCPfl crRNA, or an AsCpfl CrRNA comprising both length truncations and chemical modifications. Methods of performing gene editing using these system and reagents are also provided.