METHODS FOR IMPROVING THE EFFICIENCY OF SIMULTANEOUS SACCHARIFICATION AND FERMENTATION REACTIONS
The present disclosure is directed, in a first aspect, to the use of inverting beta xylosidase enzymes to reduce byproduct formation and increase the yield of fermentation products, as well as, in a second aspect, to the use of retaining beta 5 xylosidase enzymes to improve production of alkyl-beta-...
Gespeichert in:
Hauptverfasser: | , , , , , |
---|---|
Format: | Patent |
Sprache: | eng |
Schlagworte: | |
Online-Zugang: | Volltext bestellen |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | The present disclosure is directed, in a first aspect, to the use of inverting beta xylosidase enzymes to reduce byproduct formation and increase the yield of fermentation products, as well as, in a second aspect, to the use of retaining beta 5 xylosidase enzymes to improve production of alkyl-beta-xylopyranoside compounds, in a simultaneous saccharification and fermentation reactions. 3 of 57 Primer sequences for the construction of bx1l deletion cassette Primer Seq Primer sequence (5'+3') Description Name ID No. MH290 27 caaGGCGCGCCaagtATAACTTCGTATAAT hph reverse primer Ascl loxP site GTATGCTATACGAAGTTATCGGCCGGCG TATTGGGTGTTACG MH292 28 GAAGGCGCGCCACAGATAACTTCGTATA hph forward primer full promoter Ascl loxP GCATACATTATACGAAGTTATcctgggcttgtg site actggtcgcgag MH375 29 ccatgtcacctgtcttgaacac Bx11 5' forward MH376 30 caaggcgcGCCATCTCTTTCGATCTCAACA Bx11 5' reverse Ascl MH377 31 gattgcgatcgccgtctacaacgttttcaacc Bx11 3' forward AsiSi Acli MH378 32 GGTCCAACCTTGAATGTAACAGC Bx11 3' reverse primer MH379 33 gtgtcgctgaacataaggtctc Bx11 deletion nested forward primer MH380 34 CCTCCATTCTTCCAACAAGCC Bx11 deletion nested reverse primer Primer sequences for the construction of F. verticillioides/p-xylosidase Fv43D expression cassette Primer Name Primer sequence (5'+3') SEQ ID Forward Primer CACCATGCAGCTCAAGTTTCTGTC 35 (SK1 322) Reverse Primer GGTTACTAGTCAACTGCCCGTTCTGTAGCGAG 36 (SK1 297) Forward Primer CATGCGATCGCGACGTTTTGGTCAGGTCG 37 (SK1 236) Reverse Primer GACAGAAACTTGAGCTGCATGGTGTGGGACAACAAGAAGG 38 (SK1321) |
---|