Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 ‐20 bp), and c.315+2T>G ( IVS 2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

Bibliographische Detailangaben

Veröffentlicht in:	International journal of laboratory hematology 2017-10, Vol.39 (5), p.539-545
Hauptverfasser:	Rizo‐de‐la‐Torre, L. C., Ibarra, B., Sánchez‐López, J. Y., Magaña‐Torres, M. T., Rentería‐López, V. M., Perea‐Díaz, F. J.
Format:	Artikel
Sprache:	eng
Online-Zugang:	Volltext
Tags:	Tag hinzufügen Keine Tags, Fügen Sie den ersten Tag hinzu!