Temperature dependence of internucleotide nitrogen-nitrogen scalar couplings in RNA

The temperature dependence of internucleotide nitrogen–nitrogen scalar couplings 2hJ(N,N) across hydrogen bonds in adenine–uracil (A–U) and guanine–cytosine (G–C) base pairs of the 22 nucleotide RNA oligomer GGCGAAGUCGAAAGAUGGCGCC was studied between 280 and 310 K. The value of 2hJ(N,N) was observed to decrease monotonically for all four base pairs with increasing temperature. The temperature dependence of 2hJ(N,N) was found to be more pronounced for the A–U base pair than for G–C base pairs. An earlier study of cross‐correlation effects at 296 K appeared to indicate a reduced mobility of the A–U base pair, as evidenced by small contributions of chemical shift modulation to relaxation rates. Copyright © 2002 John Wiley & Sons, Ltd.