Raw sequencing data of a Euphausiid-specific metabarcoding marker to detect krill species of the Southern Ocean in environmental DNA samples

Progress Code: completed | Purpose To detect krill species in the Southern Ocean from environmental DNA samples. | This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon...

Ausführliche Beschreibung

Gespeichert in:
Bibliographische Detailangaben
Hauptverfasser: Suter, L., Wotherspoon, S., Kawaguchi, S., King, R., Macdonald, A., Nester, G., Polanowski, A., Raymond, B. and Deagle, B, SUTER, LEONIE, WOTHERSPOON, SIMON, KAWAGUCHI, SO, KING, ROB, MACDONALD, ANNA, NESTER, GEORGIA, POLANOWSKI, ANDREA, RAYMOND, BEN, DEAGLE, BRUCE
Format: Dataset
Sprache:eng
Schlagworte:
Online-Zugang:Volltext bestellen
Tags: Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
Beschreibung
Zusammenfassung:Progress Code: completed | Purpose To detect krill species in the Southern Ocean from environmental DNA samples. | This data set contains the raw sequencing data generated with a Euphausiid specific metabarcoding marker (Euph_F: GTGACGATAAGACCCTATA; Crust16S_R(short): ATTACGCTGTTATCCCTAAAG, amplicon size ~209 bp including primers). Samples were collected in 2019 on a resupply voyage between Davis station (Antarctica) and Hobart (Tasmania). Further information on the samples, the data and the species detected can be found in the associated publication (Suter et al. (2023) Environmental DNA of Antarctic krill (Euphausia superba): measuring DNA fragmentation adds a temporal aspect to quantitative surveys. Environmental DNA).