Solid phase phosphotriester synthesis of large oligodeoxyribonucleotides on a polyamide support

Phosphotriester solid phase methodology oo a polyamide support [(1980) Nucleic Acids Research, 8, 1081–1096] has been extended for the rapid synthesis of the tetradecanucleotide, d(AGTTGTTTGTAGTT), the octadecanucleotide, d(GTGCGTTTGGGGCAGGTC), and the heneicosanucleotide, d(GTGCTCTTATCCTCTTGGCTC)....

Ausführliche Beschreibung

Bibliographische Detailangaben

Veröffentlicht in:	Nucleic acids research 1980-11, Vol.8 (22), p.5193-5206
Hauptverfasser:	Markham, A.F., Edge, M.D., Atkinson, T.C., Greene, A.R., Heathcliffe, G.R., Newton, C.R., Scanlon, D.
Format:	Artikel
Sprache:	eng
Schlagworte:	Base Sequence Chromatography, High Pressure Liquid Chromatography, Ion Exchange Indicators and Reagents Methods Oligodeoxyribonucleotides - chemical synthesis Oligonucleotides - chemical synthesis Resins, Plant
Online-Zugang:	Volltext
Tags:	Tag hinzufügen Keine Tags, Fügen Sie den ersten Tag hinzu!