Immunostimulatory CpG Oligonucleotides Form Defined Three-Dimensional Structures: Results from an NMR Study

The DNA eicosamer 5′‐TCCATGACGTTCCTGATGCT‐3′ is known to stimulate the innate immune system of vertebrae. The immunostimulatory activity is based on the activation of Toll‐like receptor 9 (TLR9). While it is known that the CG dinucleotide of the eicosamer has to be unmethylated, the structural basis...

Ausführliche Beschreibung

Bibliographische Detailangaben

Veröffentlicht in:	ChemMedChem 2007-04, Vol.2 (4), p.549-560
Hauptverfasser:	He, Guangyu, Patra, Amritraj, Siegmund, Karsten, Peter, Mirjam, Heeg, Klaus, Dalpke, Alexander, Richert, Clemens
Format:	Artikel
Sprache:	eng
Schlagworte:	Adjuvants, Immunologic - chemistry Adjuvants, Immunologic - pharmacology CpG Islands CpG oligonucleotides DNA immunostimulation Magnetic Resonance Spectroscopy Models, Molecular NMR spectroscopy Nucleic Acid Conformation Oligonucleotides - chemistry Oligonucleotides - pharmacology structure
Online-Zugang:	Volltext
Tags:	Tag hinzufügen Keine Tags, Fügen Sie den ersten Tag hinzu!