Immunostimulatory CpG Oligonucleotides Form Defined Three-Dimensional Structures: Results from an NMR Study
The DNA eicosamer 5′‐TCCATGACGTTCCTGATGCT‐3′ is known to stimulate the innate immune system of vertebrae. The immunostimulatory activity is based on the activation of Toll‐like receptor 9 (TLR9). While it is known that the CG dinucleotide of the eicosamer has to be unmethylated, the structural basis...
Gespeichert in:
Veröffentlicht in: | ChemMedChem 2007-04, Vol.2 (4), p.549-560 |
---|---|
Hauptverfasser: | , , , , , , |
Format: | Artikel |
Sprache: | eng |
Schlagworte: | |
Online-Zugang: | Volltext |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | The DNA eicosamer 5′‐TCCATGACGTTCCTGATGCT‐3′ is known to stimulate the innate immune system of vertebrae. The immunostimulatory activity is based on the activation of Toll‐like receptor 9 (TLR9). While it is known that the CG dinucleotide of the eicosamer has to be unmethylated, the structural basis of the recognition of the DNA through the receptor remains unclear. Oligodeoxynucleotides containing the sequence of the eicosamer, or a portion thereof, ranging in length from hexamer to pentaeicosamer were studied by 1H NMR spectroscopy. Based on two‐dimensional NMR spectra, a number of resonances could be unambiguously assigned. For all oligonucleotides, structural transitions were detected upon heating, as monitored by the line width and chemical shift of low‐field resonances. This includes the TC dinucleotide of the 5′‐terminal portion, which does not have any clear base‐pairing partners. The melting transitions, together with the NOESY cross‐peaks, demonstrate that structure formation occurs well beyond the core hexamer 5′‐GACGTT‐3′, a fact that may be important for understanding the molecular recognition by the Toll‐like receptors of the innate immune system.
Structure matters. The innate immune response mediated by Toll‐like receptors distinguishes foreign DNA from host DNA. One‐ and two‐dimensional NMR studies show that immunostimulatory sequences form an unusual 3D structure. Structure information occurs beyond the core hexamer GACGTT and appears to involve the 5′ terminus. |
---|---|
ISSN: | 1860-7179 1860-7187 |
DOI: | 10.1002/cmdc.200600262 |