On the phylogeny of Phycomyces blakesleeanus. Nucleotide sequence of 5 S ribosomal RNA

The nucleotide sequence of the major 5 S ribosomal RNA from the lower fungus Phycomyces blakesleeanus has been determined. The sequence is 5' AAUCUACGGCCAUACAGAUAGUAACACACCGGAUCCCGUCUGAUCUCCGCAGUUAAGUCUCUCCUGGUAGCGUCAGUAC UAUGGUGGGGGACCACAUGGGAAUACGCUAUGUCGUAGGUU3'OH. The Phycomyces 5 S RN...

Ausführliche Beschreibung

Bibliographische Detailangaben

Veröffentlicht in:	The Journal of biological chemistry 1982-08, Vol.257 (15), p.9114-9118
Hauptverfasser:	Andersen, J, Andresini, W, Delihas, N
Format:	Artikel
Sprache:	eng
Schlagworte:	Base Sequence fungi Fungi - analysis Nucleic Acid Conformation Phycomyces - analysis RNA, Ribosomal - analysis
Online-Zugang:	Volltext
Tags:	Tag hinzufügen Keine Tags, Fügen Sie den ersten Tag hinzu!