IDENTIFICATION OF BACTERIA
A method for identifying bacteria in a sample is described which comprises amplifying a portion of the 23S rDNA present in the sample using, as one primer, a degenerate primer set comprising one or more DNA molecules consisting essentially of DNA having the sequence(s) 5'GCGATTTCYGAAYGGGGRAACCC...
Gespeichert in:
| Hauptverfasser: | , , |
|---|---|
| Format: | Patent |
| Sprache: | eng ; fre |
| Schlagworte: | |
| Online-Zugang: | Volltext bestellen |
| Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
| container_end_page | |
|---|---|
| container_issue | |
| container_start_page | |
| container_title | |
| container_volume | |
| creator | FRENCH, GARY, LAWRENCE ANTHONY, RICHARD, MICHAEL BROWN, TIMOTHY, JAMES |
| description | A method for identifying bacteria in a sample is described which comprises amplifying a portion of the 23S rDNA present in the sample using, as one primer, a degenerate primer set comprising one or more DNA molecules consisting essentially of DNA having the sequence(s) 5'GCGATTTCYGAAYGGGGRAACCC, the other primer consisting of DNA having the sequence 5'TTCGCCTTTCCCTCACGGTACT and testing the resulting amplicon by hybridisation to one or more oligonucleotide probes designed to identify one or more bacteria likely to be present in the sample. The method allows for the identification of at least 8 and considerably more bacterial species in a single test, including Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococcus spp., Klebsiella spp., Enterobacter spp., Proteus spp, Pneumococci, and coagulase negative Staphylococci. One or more novel oligonucleotides for use in this test are immobilised on a solid carrier and incorporated in a diagnostic test kit for use in hospitals and other environments.
Cette invention se rapporte à un procédé permettant d'identifier des bactéries dans un échantillon, qui consiste à amplifier une partie de l'ADNr 23S présent dans l'échantillon, en utilisant, comme première amorce, un jeu d'amorces de dégénérescence comprenant une ou plusieurs molécules d'ADN composées essentiellement par l'ADN ayant la ou les séquences: 5'GCGATTTCYGAAYGGGGRAACCC, l'autre amorce étant composée par l'ADN ayant la séquence: 5'TTCGCCTTTCCCTCACGGTACT; et à tester l'amplicon qui en résulte par hybridation avec une ou plusieurs sondes oligonucléotidiques désignées pour identifier une ou plusieurs bactéries susceptibles d'être présentes dans l'échantillon. Ce procédé permet d'identifier au moins huit espèces bactériennes et beaucoup plus, en un seul test, tel que Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococcus spp., Klebsiella spp., Enterobacter spp., Proteus spp., Pneumococci et Staphylococci négatifs de coagulase. Un ou plusieurs nouveaux oligonucléotides conçus pour être utilisés dans ce test sont immobilisés sur un support solide et incorporés dans un kit de test diagnostique à utiliser en milieu hospitalier et autres. |
| format | Patent |
| fullrecord | <record><control><sourceid>epo_EVB</sourceid><recordid>TN_cdi_epo_espacenet_WO0052203A2</recordid><sourceformat>XML</sourceformat><sourcesystem>PC</sourcesystem><sourcerecordid>WO0052203A2</sourcerecordid><originalsourceid>FETCH-epo_espacenet_WO0052203A23</originalsourceid><addsrcrecordid>eNrjZJDydHH1C_F083R2DPH091Pwd1NwcnQOcQ3ydORhYE1LzClO5YXS3AwKbq4hzh66qQX58anFBYnJqXmpJfHh_gYGpkZGBsaORsZEKAEA6pUfvw</addsrcrecordid><sourcetype>Open Access Repository</sourcetype><iscdi>true</iscdi><recordtype>patent</recordtype></control><display><type>patent</type><title>IDENTIFICATION OF BACTERIA</title><source>esp@cenet</source><creator>FRENCH, GARY, LAWRENCE ; ANTHONY, RICHARD, MICHAEL ; BROWN, TIMOTHY, JAMES</creator><creatorcontrib>FRENCH, GARY, LAWRENCE ; ANTHONY, RICHARD, MICHAEL ; BROWN, TIMOTHY, JAMES</creatorcontrib><description>A method for identifying bacteria in a sample is described which comprises amplifying a portion of the 23S rDNA present in the sample using, as one primer, a degenerate primer set comprising one or more DNA molecules consisting essentially of DNA having the sequence(s) 5'GCGATTTCYGAAYGGGGRAACCC, the other primer consisting of DNA having the sequence 5'TTCGCCTTTCCCTCACGGTACT and testing the resulting amplicon by hybridisation to one or more oligonucleotide probes designed to identify one or more bacteria likely to be present in the sample. The method allows for the identification of at least 8 and considerably more bacterial species in a single test, including Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococcus spp., Klebsiella spp., Enterobacter spp., Proteus spp, Pneumococci, and coagulase negative Staphylococci. One or more novel oligonucleotides for use in this test are immobilised on a solid carrier and incorporated in a diagnostic test kit for use in hospitals and other environments.
Cette invention se rapporte à un procédé permettant d'identifier des bactéries dans un échantillon, qui consiste à amplifier une partie de l'ADNr 23S présent dans l'échantillon, en utilisant, comme première amorce, un jeu d'amorces de dégénérescence comprenant une ou plusieurs molécules d'ADN composées essentiellement par l'ADN ayant la ou les séquences: 5'GCGATTTCYGAAYGGGGRAACCC, l'autre amorce étant composée par l'ADN ayant la séquence: 5'TTCGCCTTTCCCTCACGGTACT; et à tester l'amplicon qui en résulte par hybridation avec une ou plusieurs sondes oligonucléotidiques désignées pour identifier une ou plusieurs bactéries susceptibles d'être présentes dans l'échantillon. Ce procédé permet d'identifier au moins huit espèces bactériennes et beaucoup plus, en un seul test, tel que Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococcus spp., Klebsiella spp., Enterobacter spp., Proteus spp., Pneumococci et Staphylococci négatifs de coagulase. Un ou plusieurs nouveaux oligonucléotides conçus pour être utilisés dans ce test sont immobilisés sur un support solide et incorporés dans un kit de test diagnostique à utiliser en milieu hospitalier et autres.</description><edition>7</edition><language>eng ; fre</language><subject>BEER ; BIOCHEMISTRY ; CHEMISTRY ; COMPOSITIONS OR TEST PAPERS THEREFOR ; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL ORENZYMOLOGICAL PROCESSES ; ENZYMOLOGY ; MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEICACIDS OR MICROORGANISMS ; METALLURGY ; MICROBIOLOGY ; MUTATION OR GENETIC ENGINEERING ; PROCESSES OF PREPARING SUCH COMPOSITIONS ; SPIRITS ; VINEGAR ; WINE</subject><creationdate>2000</creationdate><oa>free_for_read</oa><woscitedreferencessubscribed>false</woscitedreferencessubscribed></display><links><openurl>$$Topenurl_article</openurl><openurlfulltext>$$Topenurlfull_article</openurlfulltext><thumbnail>$$Tsyndetics_thumb_exl</thumbnail><linktohtml>$$Uhttps://worldwide.espacenet.com/publicationDetails/biblio?FT=D&date=20000908&DB=EPODOC&CC=WO&NR=0052203A2$$EHTML$$P50$$Gepo$$Hfree_for_read</linktohtml><link.rule.ids>230,308,780,885,25564,76547</link.rule.ids><linktorsrc>$$Uhttps://worldwide.espacenet.com/publicationDetails/biblio?FT=D&date=20000908&DB=EPODOC&CC=WO&NR=0052203A2$$EView_record_in_European_Patent_Office$$FView_record_in_$$GEuropean_Patent_Office$$Hfree_for_read</linktorsrc></links><search><creatorcontrib>FRENCH, GARY, LAWRENCE</creatorcontrib><creatorcontrib>ANTHONY, RICHARD, MICHAEL</creatorcontrib><creatorcontrib>BROWN, TIMOTHY, JAMES</creatorcontrib><title>IDENTIFICATION OF BACTERIA</title><description>A method for identifying bacteria in a sample is described which comprises amplifying a portion of the 23S rDNA present in the sample using, as one primer, a degenerate primer set comprising one or more DNA molecules consisting essentially of DNA having the sequence(s) 5'GCGATTTCYGAAYGGGGRAACCC, the other primer consisting of DNA having the sequence 5'TTCGCCTTTCCCTCACGGTACT and testing the resulting amplicon by hybridisation to one or more oligonucleotide probes designed to identify one or more bacteria likely to be present in the sample. The method allows for the identification of at least 8 and considerably more bacterial species in a single test, including Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococcus spp., Klebsiella spp., Enterobacter spp., Proteus spp, Pneumococci, and coagulase negative Staphylococci. One or more novel oligonucleotides for use in this test are immobilised on a solid carrier and incorporated in a diagnostic test kit for use in hospitals and other environments.
Cette invention se rapporte à un procédé permettant d'identifier des bactéries dans un échantillon, qui consiste à amplifier une partie de l'ADNr 23S présent dans l'échantillon, en utilisant, comme première amorce, un jeu d'amorces de dégénérescence comprenant une ou plusieurs molécules d'ADN composées essentiellement par l'ADN ayant la ou les séquences: 5'GCGATTTCYGAAYGGGGRAACCC, l'autre amorce étant composée par l'ADN ayant la séquence: 5'TTCGCCTTTCCCTCACGGTACT; et à tester l'amplicon qui en résulte par hybridation avec une ou plusieurs sondes oligonucléotidiques désignées pour identifier une ou plusieurs bactéries susceptibles d'être présentes dans l'échantillon. Ce procédé permet d'identifier au moins huit espèces bactériennes et beaucoup plus, en un seul test, tel que Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococcus spp., Klebsiella spp., Enterobacter spp., Proteus spp., Pneumococci et Staphylococci négatifs de coagulase. Un ou plusieurs nouveaux oligonucléotides conçus pour être utilisés dans ce test sont immobilisés sur un support solide et incorporés dans un kit de test diagnostique à utiliser en milieu hospitalier et autres.</description><subject>BEER</subject><subject>BIOCHEMISTRY</subject><subject>CHEMISTRY</subject><subject>COMPOSITIONS OR TEST PAPERS THEREFOR</subject><subject>CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL ORENZYMOLOGICAL PROCESSES</subject><subject>ENZYMOLOGY</subject><subject>MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEICACIDS OR MICROORGANISMS</subject><subject>METALLURGY</subject><subject>MICROBIOLOGY</subject><subject>MUTATION OR GENETIC ENGINEERING</subject><subject>PROCESSES OF PREPARING SUCH COMPOSITIONS</subject><subject>SPIRITS</subject><subject>VINEGAR</subject><subject>WINE</subject><fulltext>true</fulltext><rsrctype>patent</rsrctype><creationdate>2000</creationdate><recordtype>patent</recordtype><sourceid>EVB</sourceid><recordid>eNrjZJDydHH1C_F083R2DPH091Pwd1NwcnQOcQ3ydORhYE1LzClO5YXS3AwKbq4hzh66qQX58anFBYnJqXmpJfHh_gYGpkZGBsaORsZEKAEA6pUfvw</recordid><startdate>20000908</startdate><enddate>20000908</enddate><creator>FRENCH, GARY, LAWRENCE</creator><creator>ANTHONY, RICHARD, MICHAEL</creator><creator>BROWN, TIMOTHY, JAMES</creator><scope>EVB</scope></search><sort><creationdate>20000908</creationdate><title>IDENTIFICATION OF BACTERIA</title><author>FRENCH, GARY, LAWRENCE ; ANTHONY, RICHARD, MICHAEL ; BROWN, TIMOTHY, JAMES</author></sort><facets><frbrtype>5</frbrtype><frbrgroupid>cdi_FETCH-epo_espacenet_WO0052203A23</frbrgroupid><rsrctype>patents</rsrctype><prefilter>patents</prefilter><language>eng ; fre</language><creationdate>2000</creationdate><topic>BEER</topic><topic>BIOCHEMISTRY</topic><topic>CHEMISTRY</topic><topic>COMPOSITIONS OR TEST PAPERS THEREFOR</topic><topic>CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL ORENZYMOLOGICAL PROCESSES</topic><topic>ENZYMOLOGY</topic><topic>MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEICACIDS OR MICROORGANISMS</topic><topic>METALLURGY</topic><topic>MICROBIOLOGY</topic><topic>MUTATION OR GENETIC ENGINEERING</topic><topic>PROCESSES OF PREPARING SUCH COMPOSITIONS</topic><topic>SPIRITS</topic><topic>VINEGAR</topic><topic>WINE</topic><toplevel>online_resources</toplevel><creatorcontrib>FRENCH, GARY, LAWRENCE</creatorcontrib><creatorcontrib>ANTHONY, RICHARD, MICHAEL</creatorcontrib><creatorcontrib>BROWN, TIMOTHY, JAMES</creatorcontrib><collection>esp@cenet</collection></facets><delivery><delcategory>Remote Search Resource</delcategory><fulltext>fulltext_linktorsrc</fulltext></delivery><addata><au>FRENCH, GARY, LAWRENCE</au><au>ANTHONY, RICHARD, MICHAEL</au><au>BROWN, TIMOTHY, JAMES</au><format>patent</format><genre>patent</genre><ristype>GEN</ristype><title>IDENTIFICATION OF BACTERIA</title><date>2000-09-08</date><risdate>2000</risdate><abstract>A method for identifying bacteria in a sample is described which comprises amplifying a portion of the 23S rDNA present in the sample using, as one primer, a degenerate primer set comprising one or more DNA molecules consisting essentially of DNA having the sequence(s) 5'GCGATTTCYGAAYGGGGRAACCC, the other primer consisting of DNA having the sequence 5'TTCGCCTTTCCCTCACGGTACT and testing the resulting amplicon by hybridisation to one or more oligonucleotide probes designed to identify one or more bacteria likely to be present in the sample. The method allows for the identification of at least 8 and considerably more bacterial species in a single test, including Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococcus spp., Klebsiella spp., Enterobacter spp., Proteus spp, Pneumococci, and coagulase negative Staphylococci. One or more novel oligonucleotides for use in this test are immobilised on a solid carrier and incorporated in a diagnostic test kit for use in hospitals and other environments.
Cette invention se rapporte à un procédé permettant d'identifier des bactéries dans un échantillon, qui consiste à amplifier une partie de l'ADNr 23S présent dans l'échantillon, en utilisant, comme première amorce, un jeu d'amorces de dégénérescence comprenant une ou plusieurs molécules d'ADN composées essentiellement par l'ADN ayant la ou les séquences: 5'GCGATTTCYGAAYGGGGRAACCC, l'autre amorce étant composée par l'ADN ayant la séquence: 5'TTCGCCTTTCCCTCACGGTACT; et à tester l'amplicon qui en résulte par hybridation avec une ou plusieurs sondes oligonucléotidiques désignées pour identifier une ou plusieurs bactéries susceptibles d'être présentes dans l'échantillon. Ce procédé permet d'identifier au moins huit espèces bactériennes et beaucoup plus, en un seul test, tel que Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, Enterococcus spp., Klebsiella spp., Enterobacter spp., Proteus spp., Pneumococci et Staphylococci négatifs de coagulase. Un ou plusieurs nouveaux oligonucléotides conçus pour être utilisés dans ce test sont immobilisés sur un support solide et incorporés dans un kit de test diagnostique à utiliser en milieu hospitalier et autres.</abstract><edition>7</edition><oa>free_for_read</oa></addata></record> |
| fulltext | fulltext_linktorsrc |
| identifier | |
| ispartof | |
| issn | |
| language | eng ; fre |
| recordid | cdi_epo_espacenet_WO0052203A2 |
| source | esp@cenet |
| subjects | BEER BIOCHEMISTRY CHEMISTRY COMPOSITIONS OR TEST PAPERS THEREFOR CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL ORENZYMOLOGICAL PROCESSES ENZYMOLOGY MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEICACIDS OR MICROORGANISMS METALLURGY MICROBIOLOGY MUTATION OR GENETIC ENGINEERING PROCESSES OF PREPARING SUCH COMPOSITIONS SPIRITS VINEGAR WINE |
| title | IDENTIFICATION OF BACTERIA |
| url | https://sfx.bib-bvb.de/sfx_tum?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&ctx_tim=2024-12-30T21%3A24%3A42IST&url_ver=Z39.88-2004&url_ctx_fmt=infofi/fmt:kev:mtx:ctx&rfr_id=info:sid/primo.exlibrisgroup.com:primo3-Article-epo_EVB&rft_val_fmt=info:ofi/fmt:kev:mtx:patent&rft.genre=patent&rft.au=FRENCH,%20GARY,%20LAWRENCE&rft.date=2000-09-08&rft_id=info:doi/&rft_dat=%3Cepo_EVB%3EWO0052203A2%3C/epo_EVB%3E%3Curl%3E%3C/url%3E&disable_directlink=true&sfx.directlink=off&sfx.report_link=0&rft_id=info:oai/&rft_id=info:pmid/&rfr_iscdi=true |