KIT FOR DNA DETECTION OF BOVINE IMMUNODEFICIENCY PROVIRUS CONTAINING A PAIR OF SPECIFIC PRIMERS AND PROBE AND DIAGNOSTIC TECHNIQUE FOR CATTLE IMMUNODEFICIENCY VIRUS BY POLYMERASE CHAIN REACTION IN REAL TIME
FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry. Described is kit for DNA detection of bovine immunodeficiency provirus (BIV (bovine immunodeficiency virus)), containing pair of specific primers and DNA-probe, by PCR in real time. Primers and probe have following nucleotide composit...
Gespeichert in:
Hauptverfasser: | , , , |
---|---|
Format: | Patent |
Sprache: | eng ; rus |
Schlagworte: | |
Online-Zugang: | Volltext bestellen |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
container_end_page | |
---|---|
container_issue | |
container_start_page | |
container_title | |
container_volume | |
creator | Krasnikova Ekaterina Sergeevna Krasnikov Aleksandr Vladimirovich Larionova Olga Sergeevna Utanova Gulya KHajlyatdinovna |
description | FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry. Described is kit for DNA detection of bovine immunodeficiency provirus (BIV (bovine immunodeficiency virus)), containing pair of specific primers and DNA-probe, by PCR in real time. Primers and probe have following nucleotide composition (5′-3′-): pf - TAGGGTAGTGGGATCTCAGAAATC, pr - ACATCCGTAACATCTCCTACCATC, z - GAGGATGGTAGGAGATGTTACGGAT. Source of fluorescence at 5′ end of the probe used is dye ROX and fluorescence quenching fluorescence on 3′ end of BHQ2. Also described is diagnostic technique for BIV by PCR in real time using kit according to claim. 1. Reaction mixture is prepared by mixing buffer 10-fold for PCR - 2.5 mql, dNTP (25 mM) is 0.2 mql, pf and pr primers (10 pmol/mql) by 1 mql, probe z (10 pmol/mql) is 0.5 mql, Taq polymerase (5 units/mql) is 0.2 mql, MgCl(50 mM) is 2 mql, bidistilled water is 7.6 mql, and amplification is carried out as follows: denaturation 95°C is 5 minutes, cycling: denaturation (95°C - 20 s) - annealing (55°C - 20 s) - elongation (72 C - 20 s), wherein cycle of denaturation-annealing-elongation is repeated 10 times, cycling 2 with detection: denaturation (95°C - 20 s)-annealing (55°C - 20 s)-elongation (72°C - 20 s), wherein cycle denaturation-annealing-elongation is repeated 25 or 30 times. Fluorescence is measured over a Orange channel at temperature of 55°C. Intersection of fluorescence curve line threshold, set at level of 30% of maximum level of fluorescence in last cycle amplification testifies to provirus BIV presence in sample, at that, the less value of "Ct" indicator, the higher amount of provirus BIV in analysed sample, while absence of intersection of fluorescence curve line threshold testifies to absence of provirus BIV in sample.EFFECT: invention can be used in scientific research for detecting genetic material BIV in animal blood lymphocytes by PCR in real time.2 cl, 6 dwg, 3 tbl, 2 ex
Изобретение относится к биохимии. Описан набор для выявления ДНК провируса иммунодефицита крупного рогатого скота (BIV (bovine immunodeficiency virus)), содержащий пару специфичных праймеров и ДНК-зонд, методом ПЦР в режиме реального времени. Праймеры и зонд имеют следующий нуклеотидный состав (5′-3′-): pf - TAGGGTAGTGGGATCTCAGAAATC, pr - ACATCCGTAACATCTCCTACCATC, z - GAGGATGGTAGGAGATGTTACGGAT. В качестве источника флуоресценции на 5′ конце зонда применяют краситель ROX, а для тушения флуоресценции на 3′ конце BHQ2. Также описан способ диагностики BIV методом |
format | Patent |
fullrecord | <record><control><sourceid>epo_EVB</sourceid><recordid>TN_cdi_epo_espacenet_RU2595373C1</recordid><sourceformat>XML</sourceformat><sourcesystem>PC</sourcesystem><sourcerecordid>RU2595373C1</sourcerecordid><originalsourceid>FETCH-epo_espacenet_RU2595373C13</originalsourceid><addsrcrecordid>eNqNjrFOw0AMhrMwoMI7-AUYIKoQo-NzGquJL9w5SJ2qCl0nBJXKc_JMdZuOHZj8S_5-f76v_tZi0MYEQRECG5NJVIgtNPFDlEGGYdIYuBUSVtrAmHyRpgwU1VBUdAUII0o6t_LIJM46JgOnDKjhXGn4koLgSmM2B1zVqbxPfNETmvU3bLOqcW3sN34QMwN1roXEOP865x7MhQ_V3X73dSyP17mooGWj7qkcfrbleNh9lu_yu03Ty_JtWb_W9Fz_AzkBLzxRFA</addsrcrecordid><sourcetype>Open Access Repository</sourcetype><iscdi>true</iscdi><recordtype>patent</recordtype></control><display><type>patent</type><title>KIT FOR DNA DETECTION OF BOVINE IMMUNODEFICIENCY PROVIRUS CONTAINING A PAIR OF SPECIFIC PRIMERS AND PROBE AND DIAGNOSTIC TECHNIQUE FOR CATTLE IMMUNODEFICIENCY VIRUS BY POLYMERASE CHAIN REACTION IN REAL TIME</title><source>esp@cenet</source><creator>Krasnikova Ekaterina Sergeevna ; Krasnikov Aleksandr Vladimirovich ; Larionova Olga Sergeevna ; Utanova Gulya KHajlyatdinovna</creator><creatorcontrib>Krasnikova Ekaterina Sergeevna ; Krasnikov Aleksandr Vladimirovich ; Larionova Olga Sergeevna ; Utanova Gulya KHajlyatdinovna</creatorcontrib><description>FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry. Described is kit for DNA detection of bovine immunodeficiency provirus (BIV (bovine immunodeficiency virus)), containing pair of specific primers and DNA-probe, by PCR in real time. Primers and probe have following nucleotide composition (5′-3′-): pf - TAGGGTAGTGGGATCTCAGAAATC, pr - ACATCCGTAACATCTCCTACCATC, z - GAGGATGGTAGGAGATGTTACGGAT. Source of fluorescence at 5′ end of the probe used is dye ROX and fluorescence quenching fluorescence on 3′ end of BHQ2. Also described is diagnostic technique for BIV by PCR in real time using kit according to claim. 1. Reaction mixture is prepared by mixing buffer 10-fold for PCR - 2.5 mql, dNTP (25 mM) is 0.2 mql, pf and pr primers (10 pmol/mql) by 1 mql, probe z (10 pmol/mql) is 0.5 mql, Taq polymerase (5 units/mql) is 0.2 mql, MgCl(50 mM) is 2 mql, bidistilled water is 7.6 mql, and amplification is carried out as follows: denaturation 95°C is 5 minutes, cycling: denaturation (95°C - 20 s) - annealing (55°C - 20 s) - elongation (72 C - 20 s), wherein cycle of denaturation-annealing-elongation is repeated 10 times, cycling 2 with detection: denaturation (95°C - 20 s)-annealing (55°C - 20 s)-elongation (72°C - 20 s), wherein cycle denaturation-annealing-elongation is repeated 25 or 30 times. Fluorescence is measured over a Orange channel at temperature of 55°C. Intersection of fluorescence curve line threshold, set at level of 30% of maximum level of fluorescence in last cycle amplification testifies to provirus BIV presence in sample, at that, the less value of "Ct" indicator, the higher amount of provirus BIV in analysed sample, while absence of intersection of fluorescence curve line threshold testifies to absence of provirus BIV in sample.EFFECT: invention can be used in scientific research for detecting genetic material BIV in animal blood lymphocytes by PCR in real time.2 cl, 6 dwg, 3 tbl, 2 ex
Изобретение относится к биохимии. Описан набор для выявления ДНК провируса иммунодефицита крупного рогатого скота (BIV (bovine immunodeficiency virus)), содержащий пару специфичных праймеров и ДНК-зонд, методом ПЦР в режиме реального времени. Праймеры и зонд имеют следующий нуклеотидный состав (5′-3′-): pf - TAGGGTAGTGGGATCTCAGAAATC, pr - ACATCCGTAACATCTCCTACCATC, z - GAGGATGGTAGGAGATGTTACGGAT. В качестве источника флуоресценции на 5′ конце зонда применяют краситель ROX, а для тушения флуоресценции на 3′ конце BHQ2. Также описан способ диагностики BIV методом ПЦР в режиме реального времени с использованием набора по п. 1. Реакционную смесь готовят путем смешения буфера 10-кратного для ПЦР - 2.5 мкл, дНТФ (25 мМ) - 0,2 мкл, праймеров pf и pr (10 пмоль/мкл) по 1 мкл, зонда z (10 пмоль/мкл) - 0,5 мкл, Taq полимеразы (5 ед./мкл) - 0,2 мкл, MgCl(50 мМ) - 2 мкл, бидистиллированной воды - 7,6 мкл, а амплификацию проводят в следующем режиме: денатурация 95°С - 5 мин, циклирование: денатурация (95°С - 20 с) - отжиг (55°С - 20 с) - элонгация (72°С - 20 с), причем цикл денатурация - отжиг - элонгация повторяется 10 раз, циклирование 2 с детекцией: денатурация (95°С - 20 с) - отжиг (55°С - 20 с) - элонгация (72°С - 20 с), причем цикл денатурация - отжиг - элонгация повторяется 25 или 30 раз. Флуоресценцию измеряют по каналу Orange при температуре 55°С. Пересечение кривой флуоресценции линии threshold, установленной на уровне 30% от максимального уровня флуоресценции в последнем цикле амплификации, свидетельствует о наличии в образце провируса BIV, причем, чем меньше значение показателя «Ct», тем выше количество провируса BIV в исследуемом образце, в то время как отсутствие пересечения кривой флуоресценции линии threshold свидетельствует об отсутствии провируса BIV в образце. Изобретение может быть использовано в научных исследованиях для обнаружения генетического материала BIV в лимфоцитах крови животных методом ПЦР в режиме реального времени. 2 н.п. ф-лы, 6</description><language>eng ; rus</language><subject>BEER ; BIOCHEMISTRY ; CHEMISTRY ; COMPOSITIONS OR TEST PAPERS THEREFOR ; COMPOSITIONS THEREOF ; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL ORENZYMOLOGICAL PROCESSES ; CULTURE MEDIA ; ENZYMOLOGY ; MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEICACIDS OR MICROORGANISMS ; METALLURGY ; MICROBIOLOGY ; MICROORGANISMS OR ENZYMES ; MUTATION OR GENETIC ENGINEERING ; PROCESSES OF PREPARING SUCH COMPOSITIONS ; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS ; SPIRITS ; VINEGAR ; WINE</subject><creationdate>2016</creationdate><oa>free_for_read</oa><woscitedreferencessubscribed>false</woscitedreferencessubscribed></display><links><openurl>$$Topenurl_article</openurl><openurlfulltext>$$Topenurlfull_article</openurlfulltext><thumbnail>$$Tsyndetics_thumb_exl</thumbnail><linktohtml>$$Uhttps://worldwide.espacenet.com/publicationDetails/biblio?FT=D&date=20160827&DB=EPODOC&CC=RU&NR=2595373C1$$EHTML$$P50$$Gepo$$Hfree_for_read</linktohtml><link.rule.ids>230,308,780,885,25564,76547</link.rule.ids><linktorsrc>$$Uhttps://worldwide.espacenet.com/publicationDetails/biblio?FT=D&date=20160827&DB=EPODOC&CC=RU&NR=2595373C1$$EView_record_in_European_Patent_Office$$FView_record_in_$$GEuropean_Patent_Office$$Hfree_for_read</linktorsrc></links><search><creatorcontrib>Krasnikova Ekaterina Sergeevna</creatorcontrib><creatorcontrib>Krasnikov Aleksandr Vladimirovich</creatorcontrib><creatorcontrib>Larionova Olga Sergeevna</creatorcontrib><creatorcontrib>Utanova Gulya KHajlyatdinovna</creatorcontrib><title>KIT FOR DNA DETECTION OF BOVINE IMMUNODEFICIENCY PROVIRUS CONTAINING A PAIR OF SPECIFIC PRIMERS AND PROBE AND DIAGNOSTIC TECHNIQUE FOR CATTLE IMMUNODEFICIENCY VIRUS BY POLYMERASE CHAIN REACTION IN REAL TIME</title><description>FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry. Described is kit for DNA detection of bovine immunodeficiency provirus (BIV (bovine immunodeficiency virus)), containing pair of specific primers and DNA-probe, by PCR in real time. Primers and probe have following nucleotide composition (5′-3′-): pf - TAGGGTAGTGGGATCTCAGAAATC, pr - ACATCCGTAACATCTCCTACCATC, z - GAGGATGGTAGGAGATGTTACGGAT. Source of fluorescence at 5′ end of the probe used is dye ROX and fluorescence quenching fluorescence on 3′ end of BHQ2. Also described is diagnostic technique for BIV by PCR in real time using kit according to claim. 1. Reaction mixture is prepared by mixing buffer 10-fold for PCR - 2.5 mql, dNTP (25 mM) is 0.2 mql, pf and pr primers (10 pmol/mql) by 1 mql, probe z (10 pmol/mql) is 0.5 mql, Taq polymerase (5 units/mql) is 0.2 mql, MgCl(50 mM) is 2 mql, bidistilled water is 7.6 mql, and amplification is carried out as follows: denaturation 95°C is 5 minutes, cycling: denaturation (95°C - 20 s) - annealing (55°C - 20 s) - elongation (72 C - 20 s), wherein cycle of denaturation-annealing-elongation is repeated 10 times, cycling 2 with detection: denaturation (95°C - 20 s)-annealing (55°C - 20 s)-elongation (72°C - 20 s), wherein cycle denaturation-annealing-elongation is repeated 25 or 30 times. Fluorescence is measured over a Orange channel at temperature of 55°C. Intersection of fluorescence curve line threshold, set at level of 30% of maximum level of fluorescence in last cycle amplification testifies to provirus BIV presence in sample, at that, the less value of "Ct" indicator, the higher amount of provirus BIV in analysed sample, while absence of intersection of fluorescence curve line threshold testifies to absence of provirus BIV in sample.EFFECT: invention can be used in scientific research for detecting genetic material BIV in animal blood lymphocytes by PCR in real time.2 cl, 6 dwg, 3 tbl, 2 ex
Изобретение относится к биохимии. Описан набор для выявления ДНК провируса иммунодефицита крупного рогатого скота (BIV (bovine immunodeficiency virus)), содержащий пару специфичных праймеров и ДНК-зонд, методом ПЦР в режиме реального времени. Праймеры и зонд имеют следующий нуклеотидный состав (5′-3′-): pf - TAGGGTAGTGGGATCTCAGAAATC, pr - ACATCCGTAACATCTCCTACCATC, z - GAGGATGGTAGGAGATGTTACGGAT. В качестве источника флуоресценции на 5′ конце зонда применяют краситель ROX, а для тушения флуоресценции на 3′ конце BHQ2. Также описан способ диагностики BIV методом ПЦР в режиме реального времени с использованием набора по п. 1. Реакционную смесь готовят путем смешения буфера 10-кратного для ПЦР - 2.5 мкл, дНТФ (25 мМ) - 0,2 мкл, праймеров pf и pr (10 пмоль/мкл) по 1 мкл, зонда z (10 пмоль/мкл) - 0,5 мкл, Taq полимеразы (5 ед./мкл) - 0,2 мкл, MgCl(50 мМ) - 2 мкл, бидистиллированной воды - 7,6 мкл, а амплификацию проводят в следующем режиме: денатурация 95°С - 5 мин, циклирование: денатурация (95°С - 20 с) - отжиг (55°С - 20 с) - элонгация (72°С - 20 с), причем цикл денатурация - отжиг - элонгация повторяется 10 раз, циклирование 2 с детекцией: денатурация (95°С - 20 с) - отжиг (55°С - 20 с) - элонгация (72°С - 20 с), причем цикл денатурация - отжиг - элонгация повторяется 25 или 30 раз. Флуоресценцию измеряют по каналу Orange при температуре 55°С. Пересечение кривой флуоресценции линии threshold, установленной на уровне 30% от максимального уровня флуоресценции в последнем цикле амплификации, свидетельствует о наличии в образце провируса BIV, причем, чем меньше значение показателя «Ct», тем выше количество провируса BIV в исследуемом образце, в то время как отсутствие пересечения кривой флуоресценции линии threshold свидетельствует об отсутствии провируса BIV в образце. Изобретение может быть использовано в научных исследованиях для обнаружения генетического материала BIV в лимфоцитах крови животных методом ПЦР в режиме реального времени. 2 н.п. ф-лы, 6</description><subject>BEER</subject><subject>BIOCHEMISTRY</subject><subject>CHEMISTRY</subject><subject>COMPOSITIONS OR TEST PAPERS THEREFOR</subject><subject>COMPOSITIONS THEREOF</subject><subject>CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL ORENZYMOLOGICAL PROCESSES</subject><subject>CULTURE MEDIA</subject><subject>ENZYMOLOGY</subject><subject>MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEICACIDS OR MICROORGANISMS</subject><subject>METALLURGY</subject><subject>MICROBIOLOGY</subject><subject>MICROORGANISMS OR ENZYMES</subject><subject>MUTATION OR GENETIC ENGINEERING</subject><subject>PROCESSES OF PREPARING SUCH COMPOSITIONS</subject><subject>PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS</subject><subject>SPIRITS</subject><subject>VINEGAR</subject><subject>WINE</subject><fulltext>true</fulltext><rsrctype>patent</rsrctype><creationdate>2016</creationdate><recordtype>patent</recordtype><sourceid>EVB</sourceid><recordid>eNqNjrFOw0AMhrMwoMI7-AUYIKoQo-NzGquJL9w5SJ2qCl0nBJXKc_JMdZuOHZj8S_5-f76v_tZi0MYEQRECG5NJVIgtNPFDlEGGYdIYuBUSVtrAmHyRpgwU1VBUdAUII0o6t_LIJM46JgOnDKjhXGn4koLgSmM2B1zVqbxPfNETmvU3bLOqcW3sN34QMwN1roXEOP865x7MhQ_V3X73dSyP17mooGWj7qkcfrbleNh9lu_yu03Ty_JtWb_W9Fz_AzkBLzxRFA</recordid><startdate>20160827</startdate><enddate>20160827</enddate><creator>Krasnikova Ekaterina Sergeevna</creator><creator>Krasnikov Aleksandr Vladimirovich</creator><creator>Larionova Olga Sergeevna</creator><creator>Utanova Gulya KHajlyatdinovna</creator><scope>EVB</scope></search><sort><creationdate>20160827</creationdate><title>KIT FOR DNA DETECTION OF BOVINE IMMUNODEFICIENCY PROVIRUS CONTAINING A PAIR OF SPECIFIC PRIMERS AND PROBE AND DIAGNOSTIC TECHNIQUE FOR CATTLE IMMUNODEFICIENCY VIRUS BY POLYMERASE CHAIN REACTION IN REAL TIME</title><author>Krasnikova Ekaterina Sergeevna ; Krasnikov Aleksandr Vladimirovich ; Larionova Olga Sergeevna ; Utanova Gulya KHajlyatdinovna</author></sort><facets><frbrtype>5</frbrtype><frbrgroupid>cdi_FETCH-epo_espacenet_RU2595373C13</frbrgroupid><rsrctype>patents</rsrctype><prefilter>patents</prefilter><language>eng ; rus</language><creationdate>2016</creationdate><topic>BEER</topic><topic>BIOCHEMISTRY</topic><topic>CHEMISTRY</topic><topic>COMPOSITIONS OR TEST PAPERS THEREFOR</topic><topic>COMPOSITIONS THEREOF</topic><topic>CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL ORENZYMOLOGICAL PROCESSES</topic><topic>CULTURE MEDIA</topic><topic>ENZYMOLOGY</topic><topic>MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEICACIDS OR MICROORGANISMS</topic><topic>METALLURGY</topic><topic>MICROBIOLOGY</topic><topic>MICROORGANISMS OR ENZYMES</topic><topic>MUTATION OR GENETIC ENGINEERING</topic><topic>PROCESSES OF PREPARING SUCH COMPOSITIONS</topic><topic>PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS</topic><topic>SPIRITS</topic><topic>VINEGAR</topic><topic>WINE</topic><toplevel>online_resources</toplevel><creatorcontrib>Krasnikova Ekaterina Sergeevna</creatorcontrib><creatorcontrib>Krasnikov Aleksandr Vladimirovich</creatorcontrib><creatorcontrib>Larionova Olga Sergeevna</creatorcontrib><creatorcontrib>Utanova Gulya KHajlyatdinovna</creatorcontrib><collection>esp@cenet</collection></facets><delivery><delcategory>Remote Search Resource</delcategory><fulltext>fulltext_linktorsrc</fulltext></delivery><addata><au>Krasnikova Ekaterina Sergeevna</au><au>Krasnikov Aleksandr Vladimirovich</au><au>Larionova Olga Sergeevna</au><au>Utanova Gulya KHajlyatdinovna</au><format>patent</format><genre>patent</genre><ristype>GEN</ristype><title>KIT FOR DNA DETECTION OF BOVINE IMMUNODEFICIENCY PROVIRUS CONTAINING A PAIR OF SPECIFIC PRIMERS AND PROBE AND DIAGNOSTIC TECHNIQUE FOR CATTLE IMMUNODEFICIENCY VIRUS BY POLYMERASE CHAIN REACTION IN REAL TIME</title><date>2016-08-27</date><risdate>2016</risdate><abstract>FIELD: biochemistry.SUBSTANCE: invention relates to biochemistry. Described is kit for DNA detection of bovine immunodeficiency provirus (BIV (bovine immunodeficiency virus)), containing pair of specific primers and DNA-probe, by PCR in real time. Primers and probe have following nucleotide composition (5′-3′-): pf - TAGGGTAGTGGGATCTCAGAAATC, pr - ACATCCGTAACATCTCCTACCATC, z - GAGGATGGTAGGAGATGTTACGGAT. Source of fluorescence at 5′ end of the probe used is dye ROX and fluorescence quenching fluorescence on 3′ end of BHQ2. Also described is diagnostic technique for BIV by PCR in real time using kit according to claim. 1. Reaction mixture is prepared by mixing buffer 10-fold for PCR - 2.5 mql, dNTP (25 mM) is 0.2 mql, pf and pr primers (10 pmol/mql) by 1 mql, probe z (10 pmol/mql) is 0.5 mql, Taq polymerase (5 units/mql) is 0.2 mql, MgCl(50 mM) is 2 mql, bidistilled water is 7.6 mql, and amplification is carried out as follows: denaturation 95°C is 5 minutes, cycling: denaturation (95°C - 20 s) - annealing (55°C - 20 s) - elongation (72 C - 20 s), wherein cycle of denaturation-annealing-elongation is repeated 10 times, cycling 2 with detection: denaturation (95°C - 20 s)-annealing (55°C - 20 s)-elongation (72°C - 20 s), wherein cycle denaturation-annealing-elongation is repeated 25 or 30 times. Fluorescence is measured over a Orange channel at temperature of 55°C. Intersection of fluorescence curve line threshold, set at level of 30% of maximum level of fluorescence in last cycle amplification testifies to provirus BIV presence in sample, at that, the less value of "Ct" indicator, the higher amount of provirus BIV in analysed sample, while absence of intersection of fluorescence curve line threshold testifies to absence of provirus BIV in sample.EFFECT: invention can be used in scientific research for detecting genetic material BIV in animal blood lymphocytes by PCR in real time.2 cl, 6 dwg, 3 tbl, 2 ex
Изобретение относится к биохимии. Описан набор для выявления ДНК провируса иммунодефицита крупного рогатого скота (BIV (bovine immunodeficiency virus)), содержащий пару специфичных праймеров и ДНК-зонд, методом ПЦР в режиме реального времени. Праймеры и зонд имеют следующий нуклеотидный состав (5′-3′-): pf - TAGGGTAGTGGGATCTCAGAAATC, pr - ACATCCGTAACATCTCCTACCATC, z - GAGGATGGTAGGAGATGTTACGGAT. В качестве источника флуоресценции на 5′ конце зонда применяют краситель ROX, а для тушения флуоресценции на 3′ конце BHQ2. Также описан способ диагностики BIV методом ПЦР в режиме реального времени с использованием набора по п. 1. Реакционную смесь готовят путем смешения буфера 10-кратного для ПЦР - 2.5 мкл, дНТФ (25 мМ) - 0,2 мкл, праймеров pf и pr (10 пмоль/мкл) по 1 мкл, зонда z (10 пмоль/мкл) - 0,5 мкл, Taq полимеразы (5 ед./мкл) - 0,2 мкл, MgCl(50 мМ) - 2 мкл, бидистиллированной воды - 7,6 мкл, а амплификацию проводят в следующем режиме: денатурация 95°С - 5 мин, циклирование: денатурация (95°С - 20 с) - отжиг (55°С - 20 с) - элонгация (72°С - 20 с), причем цикл денатурация - отжиг - элонгация повторяется 10 раз, циклирование 2 с детекцией: денатурация (95°С - 20 с) - отжиг (55°С - 20 с) - элонгация (72°С - 20 с), причем цикл денатурация - отжиг - элонгация повторяется 25 или 30 раз. Флуоресценцию измеряют по каналу Orange при температуре 55°С. Пересечение кривой флуоресценции линии threshold, установленной на уровне 30% от максимального уровня флуоресценции в последнем цикле амплификации, свидетельствует о наличии в образце провируса BIV, причем, чем меньше значение показателя «Ct», тем выше количество провируса BIV в исследуемом образце, в то время как отсутствие пересечения кривой флуоресценции линии threshold свидетельствует об отсутствии провируса BIV в образце. Изобретение может быть использовано в научных исследованиях для обнаружения генетического материала BIV в лимфоцитах крови животных методом ПЦР в режиме реального времени. 2 н.п. ф-лы, 6</abstract><oa>free_for_read</oa></addata></record> |
fulltext | fulltext_linktorsrc |
identifier | |
ispartof | |
issn | |
language | eng ; rus |
recordid | cdi_epo_espacenet_RU2595373C1 |
source | esp@cenet |
subjects | BEER BIOCHEMISTRY CHEMISTRY COMPOSITIONS OR TEST PAPERS THEREFOR COMPOSITIONS THEREOF CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL ORENZYMOLOGICAL PROCESSES CULTURE MEDIA ENZYMOLOGY MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEICACIDS OR MICROORGANISMS METALLURGY MICROBIOLOGY MICROORGANISMS OR ENZYMES MUTATION OR GENETIC ENGINEERING PROCESSES OF PREPARING SUCH COMPOSITIONS PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS SPIRITS VINEGAR WINE |
title | KIT FOR DNA DETECTION OF BOVINE IMMUNODEFICIENCY PROVIRUS CONTAINING A PAIR OF SPECIFIC PRIMERS AND PROBE AND DIAGNOSTIC TECHNIQUE FOR CATTLE IMMUNODEFICIENCY VIRUS BY POLYMERASE CHAIN REACTION IN REAL TIME |
url | https://sfx.bib-bvb.de/sfx_tum?ctx_ver=Z39.88-2004&ctx_enc=info:ofi/enc:UTF-8&ctx_tim=2024-12-26T08%3A53%3A19IST&url_ver=Z39.88-2004&url_ctx_fmt=infofi/fmt:kev:mtx:ctx&rfr_id=info:sid/primo.exlibrisgroup.com:primo3-Article-epo_EVB&rft_val_fmt=info:ofi/fmt:kev:mtx:patent&rft.genre=patent&rft.au=Krasnikova%20Ekaterina%20Sergeevna&rft.date=2016-08-27&rft_id=info:doi/&rft_dat=%3Cepo_EVB%3ERU2595373C1%3C/epo_EVB%3E%3Curl%3E%3C/url%3E&disable_directlink=true&sfx.directlink=off&sfx.report_link=0&rft_id=info:oai/&rft_id=info:pmid/&rfr_iscdi=true |