New oligonucleotide, comprising specified sequences, is argonaute-3a expression inhibitor, useful for diagnosing or treating disorders or diseases e.g. angiogenesis, hematopoiesis, embryogenesis or microRNA-biogenesis
Oligonucleotide comprising one or more sequences comprising SEQ ID NOs: 1-7, is new. Oligonucleotide, comprising one or more sequences including agaaaaatgaacgccccaca (SEQ ID NO: 1), cttctggagcggagaaaaat (SEQ ID NO: 2), ctagtggcaggtaggtgtgt (SEQ ID NO: 3), gtgcaggtatagaaacagat (SEQ ID NO: 4), cagactt...
Gespeichert in:
Hauptverfasser: | , , |
---|---|
Format: | Patent |
Sprache: | eng ; ger |
Schlagworte: | |
Online-Zugang: | Volltext bestellen |
Tags: |
Tag hinzufügen
Keine Tags, Fügen Sie den ersten Tag hinzu!
|
Zusammenfassung: | Oligonucleotide comprising one or more sequences comprising SEQ ID NOs: 1-7, is new. Oligonucleotide, comprising one or more sequences including agaaaaatgaacgccccaca (SEQ ID NO: 1), cttctggagcggagaaaaat (SEQ ID NO: 2), ctagtggcaggtaggtgtgt (SEQ ID NO: 3), gtgcaggtatagaaacagat (SEQ ID NO: 4), cagacttctagtggcaggta (SEQ ID NO: 5), ccctgccacaatattacagactt (SEQ ID NO: 6) or gttgccctgccacaatatta (SEQ ID NO: 7), is new. Independent claims are included for: (1) a vector comprising the oligonucleotide; (2) a nucleic acid construct comprising the oligonucleotide and a detectable marker; (3) a composition comprising the oligonucleotide, optionally in conjunction with one or more adjuvants, diluents and/or carriers; (4) a diagnostic composition comprising the oligonucleotide or the nucleic acid construct; (5) specifically inhibiting the expression of ago-3 in a cell in vitro, comprising introducing the oligonucleotide or the vector in the cell, and providing suitable hybridization conditions; and (6) detecting ago-3 mRNA in a cell in vitro, comprising introducing the nucleic acid construct in a cell, providing the suitable hybridization conditions and detecting the detectable marker. ACTIVITY : Angiogenesis Inhibitor; Antianemic; Anticonvulsant; Nootropic; Cytostatic. MECHANISM OF ACTION : Ago-3a expression inhibitor; Ago-3b expression inhibitor. The ability of the oligonucleotide to inhibit human Ago-3a mRNA expression was tested in vitro in ECV304 cells. The results showed that the asAgo3-1 (SEQ ID NO: 1) exhibited an IC 50value of 10 nM.
Die vorliegende Erfindung betrifft ein Oligonukleotid, das spezifisch an das Protein Argonaute-3 kodierende mRNA hybridisiert. Mit Hilfe dieses Oligonukleotids kann die Expression von Ago-3 gehemmt und Ago-3 mRNA nachgewiesen werden. Die vorliegende Erfindung betrifft weiter pharmazeutische Zusammensetzungen, enthaltend dieses Oligonukleotid, Verfahren zur spezifischen Hemmung der Ago-3 Expression und zum Nachweis von Ago-3 mRNA sowie die Verwendung dieses Oligonukleotids zur Hemmung der Expression von Ago-3 in einer Zelle. |
---|