Treffer 1 - 3 von 3 für Suche 'Rentería‐López, V. M.', Suchdauer: 0,77s Treffer weiter einschränken
  1. 1
    Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

    Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassem... von Rizo‐de‐la‐Torre, L. C., Ibarra, B., Sánchez‐López, J. Y., Magaña‐Torres, M. T., Rentería‐López, V. M., Perea‐Díaz, F. J.


    Volltext
    Artikel

    Zu den Favoriten
    Gespeichert in:
  2. 2
    Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 ‐20 bp), and c.315+2T>G ( IVS 2:2 T>G). Update of the mutational spectrum of β‐Thalassemia in Mexican mestizo patients

    Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 ‐20 bp), and c.315+2T>G ( IVS 2:2 T>G). Update of the mutational spectrum of β‐Thala... von Rizo‐de‐la‐Torre, L. C., Ibarra, B., Sánchez‐López, J. Y., Magaña‐Torres, M. T., Rentería‐López, V. M., Perea‐Díaz, F. J.


    Volltext
    Artikel

    Zu den Favoriten
    Gespeichert in:
  3. 3
    Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20ￂ bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of [beta]-Thalassemia in Mexican mestizo patients

    Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20ￂ bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of [beta]-Tha... von Rizo-de-la-Torre, L C, Ibarra, B, Sanchez-Lopez, J Y, Magana-Torres, M T, Renteria-Lopez, V M, Perea-Diaz, F J


    Volltext
    Artikel

    Zu den Favoriten
    Gespeichert in:

Suchwerkzeuge: