Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women von González-Mercado, A, Sánchez-López, J Y, Regla-Nava, J A, Gámez-Nava, J I, González-López, L, Duran-Gonzalez, J, Celis, A, Perea-Díaz, F J, Salazar-Páramo, M, Ibarra, B

Volltext

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 ‐20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β‐Thalassem... von Rizo‐de‐la‐Torre, L. C., Ibarra, B., Sánchez‐López, J. Y., Magaña‐Torres, M. T., Rentería‐López, V. M., Perea‐Díaz, F. J.

Volltext

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha0-thalassemia deletions - -M... von de-la-Cruz-Salcedo, E. I., Ibarra, B., Rizo-de-la-Torre, L. C., Sánchez-López, J. Y., González-Mercado, A., Harteveld, C. L., Perea-Díaz, F. J.

Volltext

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions -... von de-la-Cruz-Salcedo, E I, Ibarra, B, Rizo-de-la-Torre, L C, Sánchez-López, J Y, González-Mercado, A, Harteveld, C L, Perea-Díaz, F J

Volltext

Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico von Rizo-de la Torre, L C, Borrayo-López, F J, Perea-Díaz, F J, Aquino, E, Venegas, M, Hernández-Carbajal, C, Espinoza-Mata, L L, Ibarra-Cortés, B

Volltext

Three novel HBB mutations, c.‐140C>G (‐90 C>G), c.237_256del GGACAACCTCAAGGGCACCT ( FS Cd 78/85 ‐20 bp), and c.315+2T>G ( IVS 2:2 T>G). Update of the mutational spectrum of β‐Thala... von Rizo‐de‐la‐Torre, L. C., Ibarra, B., Sánchez‐López, J. Y., Magaña‐Torres, M. T., Rentería‐López, V. M., Perea‐Díaz, F. J.

Volltext

Molecular analysis of complex cases of alpha‐ and beta‐thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha 0 ‐thalassemia deletions ‐... von de‐la‐Cruz‐Salcedo, E. I., Ibarra, B., Rizo‐de‐la‐Torre, L. C., Sánchez‐López, J. Y., González‐Mercado, A., Harteveld, C. L., Perea‐Díaz, F. J.

Volltext

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20ￂ bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of [beta]-Tha... von Rizo-de-la-Torre, L C, Ibarra, B, Sanchez-Lopez, J Y, Magana-Torres, M T, Renteria-Lopez, V M, Perea-Diaz, F J

Volltext

Digestion of Erythrocytes by Entamoeba histolytica: Correlative Study with Scanning Electron Microscopy and Polyacrylamide Gel Electrophoresis von Mora-Galindo, Juan, González-Robles, Arturo, Alvarez, Dolores, Perea-Dı́az, F.Javier, Anaya-Velázquez, Fernando

Volltext

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha super(0)-thalassemia deleti... von de-la-Cruz-Salcedo, E I, Ibarra, B, Rizo-de-la-Torre, L C, Sanchez-Lopez, J Y, Gonzalez-Mercado, A, Harteveld, CL, Perea-Diaz, F J

Volltext